1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kay [80]
3 years ago
13

What is 10% of 100.00

Biology
1 answer:
stich3 [128]3 years ago
4 0

The Answer is

10. Im good at maths

You might be interested in
Your 1 st section should be about reproduction in humans.
jekas [21]

The human reproductive system is different in males and females. When a sperm and egg join, the egg is fertilised and a baby starts to develop. Its mother provides all a baby’s needs until it is born.Fertilisation happens when an egg cell meets with a sperm cell and joins with it. The fertilised egg divides to form a ball of cells called an embryo. The embryo attaches to the lining of the uterus. It begins to develop into a fetus and finally into a baby.The mother’s lifestyle can affect the developing fetus. For example, smoking reduces the amount of oxygen in the bloodstream. This can lead to low birth weight and premature birth (when a baby is born too soon). Drinking alcohol during pregnancy can harm the developing baby’s nervous system, especially its brain.

Birth

It takes about 40 weeks for a baby to develop in the uterus. This time is called gestation. After this, the baby is ready to be born. The cervix relaxes and muscles in the wall of the uterus contract. Waves of muscle contraction push the baby out of the mother's body through the vagina.

4 0
4 years ago
From the anthocyanid and beets experimento match each variable with it's appropriate part of the
NeX [460]

A standardized variable is, in terms of scientific experimentation, more commonly referred to as a control or constant variable.

<em>Though I was unable to locate the full question in order to provide an answer specific to this question, allow me to provide a general overview of the role each variable plays within an experiment, thus allowing you to use this information towards your specific experiment. </em>

<em />

<em />

In order to perform a successful experiment, we can identify at least three kinds of variables, these are:

  • Independent variable
  • dependent variable
  • Control variable

In an experiment, the Independent variable is one whose value does not depend on the others. What this means is that this variable will<u> not react to changes that occur in others</u>. One example of this can be the <em>color of light</em> in an experiment to test <em>how colored light affects plant growth</em>. We know this is the independent variable here because the color of the light is not affected by the species of plant, type of soil, or any other variable present.

The dependent variable in an experiment is just the opposite, it is, as the name implies, a variable whose value<u> depends on the other variables present</u>. In any experiment, this variable represents<u> the data that we seek to measure.</u> For the example given above, it would correspond to the growth of the plants.

Finally, the last variable we must identify is that of the control variable, also known as the constant or standardized variable. This variable is of vital importance for the accuracy of any experiment. This variable corresponds <u>to those factors which we maintain </u><u>constant </u><u>through each trial in the experiment,</u> for the example above, keeping the kind of soil or species of plant constant through each test.

This is done in order to minimize the factors that may affect the outcome of the experiment, and this way, in the presence of any change, we can attribute that change to the correct factor that caused it.

To learn more visit:

brainly.com/question/1029540?referrer=searchResults

6 0
3 years ago
After a major crude oil spill, a variety of specific microbes is distributed in the area of the spill. this would be an example
jasenka [17]

After a major crude oil spill, a variety of specific microbes is distributed in the area of the spill. this would be an example of Bioremediation

<h3>What is Bioremediation ?</h3>

A subfield of biotechnology called "bioremediation" uses living things like bacteria and microorganisms to clean up contaminated environments. It is used to clean up poisons, pollutants, and other contaminants from water, soil, and other habitats.

  • Bioremediation refers to the removal of biological fluids and blood that may include pathogens like hepatitis, HIV, and MRSA or pose other health problems. Crime scene cleaners employ enzyme cleansers rather than conventional cleaning products like bleach or ammonia to get rid of dangerous compounds from the site.

  • Microbial bioremediation, phytoremediation, and mycoremediation are a few of the most popular types of bioremediation.

Learn more about Bioremediation here:

brainly.com/question/26430794

#SPJ4

8 0
2 years ago
You have spent time working with a population of beetles. Males range in size from 2 to 6 cm in body length. You realize that th
IrinaVladis [17]

Answer:

B. No

Explanation:

First, let's watch what it looks like when a population is not evolving. If a population is in a state called Hardy-Weinberg equilibrium, the frequencies of alleles, or gene versions, and genotypes, or sets of alleles, in that population will stay the same over generations (and will also satisfy the Hardy-Weinberg equation). Formally, evolution is a change in allele frequencies in a population over a very long period of time, so a population in Hardy-Weinberg equilibrium is not evolving.

4 0
4 years ago
Read 2 more answers
List five factors or behaviors that affect cholesterol levels in the body, how these factors affect cholesterol levels, and whet
anyanavicka [17]
Hey there,
Q1 & Q2) 
1) Heredity- Genes carry genetic information for cholesterol. So, it can be passed down from your parents.
2) Diet- Cholesterol depends on the food you eat. If you eat food with too much saturated fat, you get a high level of cholesterol. 
3) Weight- If you are obese, you are more prone to get cholesterol. Thus, you need to lose weight
4) Exercise- Exercise regularly to maintain a perfect cholesterol level
5) Stress- If you are a student, take breaks in between study timings to keep you less stress or if you are an adult, go for walks and do something that you like the most to calm your brain down.

Q3) Cholesterol causes plague to grow in your hearts. This thick, hard plague will block the arteries and will cause heart attacks and strokes. 

Q4) Pros- <span>Helps maintain healthy cholesterol levels, lowers risks of heart attacks and strokes
       Cons- C</span><span>ould create too many HDL leaving not enough cholesterol for the body to be healthy.

Hope this helps :))

~Top
</span>
7 0
3 years ago
Other questions:
  • Flagellates are microbes that have a rod-shaped flagellum that helps with their locomotion. Certain flagellates reside inside te
    5·2 answers
  • In your own words, what is an antigen?
    8·1 answer
  • Do dogs have Endocrine Respiratory Circulatory Digestive Skeletal Muscular Nervous ​Urinary systems
    12·1 answer
  • Why is rest so essential to maintain metabolism and a healthy eight?
    13·1 answer
  • ________________________ is symmetry around a point, as in a sea star.
    13·1 answer
  • Will give brainliest plz help
    10·1 answer
  • What are the phenotypes for YY, Yy, yy. Where Yellow (Y) hair is dominant to blue (y)?
    8·2 answers
  • 1-True or False: Human activities such as nitrogen fertilizer can upset the balance of the nitrogen cycle.
    7·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which of the following is NOT a reactant
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!