1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
UNO [17]
2 years ago
15

What are the four factors that determine a population's growth rate?

Biology
2 answers:
nekit [7.7K]2 years ago
8 0
Pick the one that gets to your heart
scoray [572]2 years ago
4 0

Answer:

I think it's d

Explanation:

You might be interested in
A slow reproduction process is a disadvantage of which form of reproduction
Musya8 [376]
Sexual reproduction

Hope I Helped You!!! :-)

Have A Good Day!!!
5 0
2 years ago
Read 2 more answers
Describe the effect on an enzyme of an increase in environmental temperature above the optimum temperature range of the enzyme.
Luden [163]

Answer:

In an environmental temperature above optimum temperature will cause the enyzmes to denature (deform), because when they denature the subtrate will no longer fit into the enzyme

6 0
2 years ago
What nucleotide is used during transcription instead of thymine
enyata [817]
It differs from DNA chemically in two respects: (1) the nucleotides in RNAare ribonucleotides—that is, they contain the sugar ribose (hence the name ribonucleic acid) rather than deoxyribose; (2) although, like DNA,RNA contains the bases adenine (A), guanine (G), and cytosine (C), it contains the base uracil (U) .
3 0
2 years ago
What does not require the breakdown of ATP?
EastWind [94]
Diffusion -SKx is your answer. Hope this helps! ;D
6 0
2 years ago
After carrying out some tests at a local stream, you discover that the pH in the stream is extremely low. Based on this, you sho
Bezzdna [24]
Take care of the stream better? Or to not polite the water. I’m guessing so sorry if you get this wrong
4 0
3 years ago
Read 2 more answers
Other questions:
  • An infant is admitted to the nursery after a difficult shoulder dystocia vaginal birth. which condition should the nurse careful
    5·1 answer
  • Very low concentrations of detergent make membranes leaky to small molecules and ions without damaging proteins. In isolated mit
    13·1 answer
  • Explain how the shape of a finch's beak is an example of an adaptation?
    7·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which of the following elements is known as "nuclear ash" when it forms inside a star?
    9·1 answer
  • A particular triplet of bases in the coding strand of DNA is 5'-CGT-3: Which of
    9·1 answer
  • Cuales son las caracteristicas y organos q desarrolla el embrion y el feto por trimestre
    5·1 answer
  • Which of the following is abiotic?<br> an earthworm<br> a mosquito<br> a flood<br> none of these
    13·1 answer
  • HELP ME ASAP PLEASE.<br><br>How does water move from leaves to root? explain ​
    12·2 answers
  • 2. What do you notice about the cellular respiration and<br> photosynthesis equations?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!