Explanation: because carry out all the functions in the human body necessary for living. Proteins make up hormones that are required for living. Insulin - responsible for stabilising blood sugar. Haemoglobin - responsible for carrying oxygen around the body. Melatonin - responsible for helping us get to sleep. Adrenalin - responsible for the flight-fight-freeze response. There are many more but here are just a few.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The correct statements are-
Erosion occurs even when the mountains are forming. Erosion is the movement of sediments from the broken rocks through the agents like gravity, wind, water and others. It is a constant process occurring even while the mountains are forming. It is affected by gravity.
When new mountains or plateaus form, the cycle starts over. Weathering is the breakdown of rocks by the weathering agents. These sediments move due to the process of erosion. A new sediment may be dropped nearby or in a new place by the process of deposition. Weathering, erosion and deposition occur together as a cycle and have almost leveled the land surface.
Weathering, erosion and deposition have almost leveled earth’s surface. These three processes occur as a cycle and have almost leveled the land surface.
The answers are A) ectoderm and B) endoderm.
Fertilization is a fusion of male and female gametes which leads to the formation of a zygote. The zygote undergoes mitosis and transforms into a single-layered blastula. Gastrulation is a transformation of the blastula into a two-layer or three-layer gastrula. Cnidarians are a diploblastic animal because their gastrula has only two layers - endoderm and ectoderm.
