1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
I am Lyosha [343]
3 years ago
6

HELP ME!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Mathematics
1 answer:
Bezzdna [24]3 years ago
5 0
The answer is option C. 9xy sqrt 2x
You might be interested in
A total of 937 people attended the play.
ra1l [238]

Answer:

612 adults & 361 students

Step-by-step explanation:

4 0
3 years ago
A rectangular prism has a length of 20 in a width of 2 in and a height of 3 1/4 in the prism is filled with cubes that have edge
Zinaida [17]
You can express the edge lengths in terms of "cubes" or you divide the total volume by the volume of a cube. It works either way.

Edge lengths are
.. 80 cubes by 8 cutes by 13 cubes
so total volume is
.. (80 * 8 * 13) = 8320 cubes


In cubic inches, the volume is
.. (20 in)*(2 in)*(3 1/4 in) = 130 in^3.
The volume of a 1/4-in cube is (1/4 in)^3 = 1/64 in^3.
Then the number of cubes that will fit in the prism is
.. (130 in^3)/(1/64 in^3) = 8320 . . . . cubes

8320 cubes are needed to fill the rectangular prism.
7 0
4 years ago
100 5 90 10 80 15 70 next term in the sequence?
max2010maxim [7]

Answer:

20

Step-by-step explanation:

6 0
4 years ago
The area of shape A is 3 cm?<br> А<br> What is the area of shape B?<br> B<br> isometric<br> grid
otez555 [7]

Answer:

the area is 28.5

Step-by-step explanation:

because one Dimondale shape is worth 3 and half or a diamond shape is worth 1.5

3 0
3 years ago
What is the length of side x?
Feliz [49]

Answer:

7 cm

Step-by-step explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Help with maths HW please I'm dyinnnnnnggggg
    7·2 answers
  • Consider the following hypotheses:
    7·1 answer
  • james has for four and three forths feet of rope he plans to cut off one and a half feet from the rope how much will rope be lef
    10·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Create a factorable polynomial with a GCF of 2y. Rewrite that polynomial in two other equivalent forms. Explain how each form wa
    9·1 answer
  • In how many ways you can put 20 books on 50 shelves so that there is not more than one book on a shelf?
    15·1 answer
  • PLEASE HELP (25 POINTS) <br><br> WHICH ONE IS IT
    10·1 answer
  • cary's barbecue sauce recipe calls for 2 2/3 cups of water for every 8 pints of tomato sauce how menu cups of water does cary us
    12·2 answers
  • Factor the trinomial below.<br> x2 + 4x - 21
    7·1 answer
  • 3x−4/5=−1/2<br> What is the value of x?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!