Answer: Option D
Explanation:
If a DNA sequence is altered from TAGCTGA to TAGTGA, the kind of mutation that has occurred is DELETION.
Deletion is a kind of small-scale mutation in which one or more nucleotides is removed from the DNA. This mutation can alter the reading frame of the gene, and it is irreversible.
Plant and animal cells are very similar because they are both eukaryotic cells.
Answer:
The Lungs
Explanation:
Asthma is a lung disease that affects your airways. With asthma, the lining of your airways is constantly hypersensitive, resulting in redness and swelling (inflammation). It's similar to how sunburned skin turns red, irritated, and sensitive. The airways become hypersensitive to things you are exposed to on a daily basis, or asthma "triggers." a trigger could be a common cold, stress, changes in the weather, or environmental factors like dust, chemicals, smoke, or pet dander.
Airway remodeling can occur as a result of poor asthma management. When asthma is untreated or poorly managed, it can lead to airway remodeling, which is a serious condition. The lungs become scarred, asthma medications become less effective, and less air can pass through your airways. It is not necessary to remodel the airways.
Hope this helps and if it does, don't be afraid to give my answer a "Thanks" and maybe a Brainliest if it's correct?
Answer:
what element is all life based on
Explanation:
the element is element carbon
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
