1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex_Xolod [135]
3 years ago
6

Which shows a correct order to solve this story problem?

Mathematics
1 answer:
Sedaia [141]3 years ago
3 0
The answers are as follows,
B
D
C
C
B
Hope this helps.
You might be interested in
7th GRADE WORK HELPPP!!! ILL BRAINLIST!!!
Ksenya-84 [330]

Answer: Rachel's prediction is faster than the actual unit rate, and Theadore's prediction is slower.

6 0
3 years ago
Read 2 more answers
Find an angle 0 coterminal to 904°, where 0° < 0 < 360°
borishaifa [10]

Answer:

184

Step-by-step explanation:

What you can do is just divide 904/360 and the remeinder is the answer so for this 1080 is too big so 720 and it is 904-720=184

4 0
3 years ago
Jo's collection contains US, Indian and British stamps. If the ratio of US to Indian stamps is 5 to 2 and the ratio of Indian to
andreev551 [17]

Answer:(E). 25:2

Step-by-step explanation:

First ratio:

Us : India is 5 : 2

Second ratio

India : British is 5 : 1

multiply(5:2) by 5 and multiply (5:1) by 2 to balance the India stamps.

Therefore now

Us : India is 25 : 10

India : British is 10 : 2

The ratio of us : British is 25:2

5 0
3 years ago
4x6.2= 4(6+0.2) = (4x ) + (4 x )
PSYCHO15rus [73]

Answer:

X=3.1

(4•3.1)+(4•3.1)

Step-by-step explanation:

4 of 6.2 is equal to 24.8

4•(6+0.2) = 24.8

4•3.1=12.4•2=24.8

12.4+12.4=24.8

(4x)+(4×)=24.8

5 0
3 years ago
Julia plays volleyball and finished the regular season with 25 digs. The graph relates her total number of digs for the season t
Law Incorporation [45]
We need to find an equation in the form y=mx+b.

To find m, we use the formula:
m=\frac{y_{2}-y_{1}}{x_{2}-x_{1}}

We'll use the points (0, 25) and (4, 37):
m=\frac{37-25}{4-0}=\frac{12}{4}=3

The value of b (the y-intercept) is the value of y when x=0, which is 25.

So the equation is y=3x+25 (choice A).
6 0
3 years ago
Read 2 more answers
Other questions:
  • Liz is a student in Ms. Xu's class. Liz says to her classmates, "Of all the pairs of students Ms. Xu can choose as class leaders
    15·1 answer
  • Four different sets of objects contain 2,5,6, and 7 objects, respectively. How many unique combinations can be formed by picking
    7·1 answer
  • 17 teaspoons =<br> tablespoons
    12·2 answers
  • If each iTunes song costs $0.99 and Wade bought 24 songs, how much was the total cost?
    14·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Can someone help? Thanks :D
    7·1 answer
  • Using a number cube and a
    6·1 answer
  • A cook used 6 gal of cooking oil last month. She used 15% less this
    10·1 answer
  • What is the number that is two more than one-tenth of one-fifth of one-tenth of 2,000​
    15·1 answer
  • Can you help me out ​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!