1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anzhelika [568]
3 years ago
7

During what process in the cell cycle does one cell become two cells?

Biology
2 answers:
jonny [76]3 years ago
6 0
In the <span>cytokineses, one cell becomes two. </span>
m_a_m_a [10]3 years ago
5 0

Answer:   cytokinesis

i got it right on ze test!

You might be interested in
Jasmine earned $150 last week.Jay earned $130 last week. they combined their money and decided to donate 1/4 of their total amou
vova2212 [387]
Last night Jasmine and Jay amount combined is $150+$130=$280
amount donated to charity is 1/4 of $280= $70
amount spent at an amusement park is` 40/100 x $210= $84
the remaining money = 280- (70+84)= $126

35% of their original amount is 35/100x$280=$98

so Jay's claim is not correct because the remaining money is $126 and not $98 as she Jay claims.
8 0
3 years ago
Which part of the plant cell absorbs the energy needed for the process
jekas [21]

Answer: chloroplasts

Explanation:

8 0
2 years ago
Read 2 more answers
A cell that contains chloroplasts, a nucleus, and mitochondria is discovered. Biologists might decide it could
Tom [10]

Answer:

eukaryotic cell

Explanation:

because prokaryotic cells lack nucleus

5 0
2 years ago
Read 2 more answers
Rule: 7-tongue roller, 1 - non roller
kozerog [31]

Answer:

<em>See attached punnet square</em>

Explanation:

Attached is the punnet square that shows the Mendelian assortment of the allele for tongue rolling between a homozygous dominant  and heterozygous parents.

Genotype  Probability

TT           50%

Tt           50%

Phenotype         Probability

Tongue Roller 100%

8 0
3 years ago
How important is your skin for the functioning of the nervous system?
White raven [17]

Answer:

The skin is very important for the functioning of the nervous system, this is because, it serves as the sensory organ, which transmit the sense of touch to the brain for interpretation. The skin acts as the receptors of stimuli that are coming from outside of the body. For instance, if one mistakenly touch an hot pot with a bare hand, one will quickly remove the hand immediately. This is because the skin was able to sense the touch of hotness and send the information to the brain for the correct interpretation of the stimuli. Therefore, without the skin, the functioning of the nervous system will be impaired.  

6 0
3 years ago
Other questions:
  • I’m what stage of cellular respiration is most of the carbon dioxide produced?
    9·2 answers
  • This paragraph attempts to explain the rain shadow effect, but it gets some of the facts wrong. Identify the inaccurate statemen
    9·2 answers
  • A variable-ratio schedule reinforces behavior after a:
    10·1 answer
  • What are the four main stages of Interphase?
    15·1 answer
  • Which of the phrases from the paragraph is an example of a simile?
    10·1 answer
  • Will give brainliest<br> What is this?
    5·1 answer
  • Which of the following is true of the water at the bottom of the ocean?
    5·1 answer
  • Increasing the intensity of a stimulus may increase which of the following?
    12·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • What happens in meiosis during anaphase 1
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!