1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
-Dominant- [34]
3 years ago
10

The production of endogenous very low-density lipoproteins (vldls) is decreased by

Biology
1 answer:
ivolga24 [154]3 years ago
6 0
I believe the vldls is decreased by Exercise.
You might be interested in
The only cellular respiration process that can be considered anaerobic is _____.
Nesterboy [21]

The correct answer is fermentation.

The production of energy needs oxygen. The electron transport chain, where the most of ATP is produced, needs a huge input of oxygen. However, there are various species, which have produced methods to continue the metabolism in the absence of oxygen, or can move from aerobic to anaerobic cell respiration when oxygen is enough.

At the time of cellular respiration, some of the living species utilize an organic substance as the eventual electron acceptor. The procedures that utilize an organic molecule to reproduce NAD+ from NADH are in a combination known as fermentation.

In comparison, some of the living species utilize an inorganic substance as an ultimate electron acceptor. Both the procedures are known as anaerobic cellular respiration, where the species are obtaining energy for their application in the absence of oxygen.

7 0
3 years ago
How are niche and habitat related?
Sergio039 [100]

Answer:C

Explanation:The role a species plays in the ecosystem is called its niche. A habitat is the physical environment in which a species lives.

6 0
3 years ago
Which of the following are assumptions the t-test makes? (choose all that apply)
arlik [135]

Answer:

Which of the following are assumptions the t-test makes?

variances in each group are equal

the collected data are normally distributed

Explanation:

There is equality in assumptions for t-test also all data collected are not skewed rather they are normally distributed

3 0
3 years ago
How does the body respond to changes in its environment
Hunter-Best [27]
Response is an important characteristic of life. Anything that causes a living organism to react<span> is also called the stimulus,</span><span>t helps the organism to stay in balance.</span>
5 0
3 years ago
Read 2 more answers
QueSUI SUI TU
slavikrds [6]

Answer:

b and d

Explanation:

3 0
3 years ago
Other questions:
  • Which of the following plant adaptations aids grassland plants to recover from fires?
    11·1 answer
  • What happened to Queen Victoria's Family who suffered from Hemophilia? ​
    7·1 answer
  • Changes in the genetic constitution of an organism may be due to which of the following?
    5·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Which cells support a plant stem
    15·2 answers
  • HELP!!!! i’ll give branliest
    10·1 answer
  • What is chorionic villus sampling?
    6·1 answer
  • Which elements combine to form carbohydrates?
    5·2 answers
  • Science test please help me!!
    11·2 answers
  • Four cells are produced at the
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!