1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stella [2.4K]
3 years ago
7

In many plants, stomata are found only on the lower surface of the leaf. The most likely explanation for this fact is that

Biology
1 answer:
sergejj [24]3 years ago
6 0
D. Plants have adapted to deal with the sun in many different ways, and this is one. The stomata are regulated by guard cells, which are activated by different things depending on the species of plant, and guard cells are supposed to keep the stomata from staying open all the time and losing too much water to evaporation. So, the solution is to have the stomata on the bottom of the leaf to prevent direct sunlight contact (and therefore more evaporation), and guard cells to protect the stomata. 
You might be interested in
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
Elden [556K]

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

4 0
3 years ago
Which of the following is NOT a strategy
adelina 88 [10]

Answer:

A

Explanation:

if you hide a storm drain it really doesn't do much because it doesn't clean the water, and all of the other options do clean water of contaminants.

7 0
2 years ago
Which action causes the movement of atmospheric heat from place to place in the troposphere?
kvv77 [185]

Answer:

Cold air is denser than warm air, it will sink below warmer air, pushing warm air upward.

Explanation:

8 0
2 years ago
I need help. The class of macromolecule that would most likely be involved in contracting muscles would be ?
Juliette [100K]

Answer:

B

Explanation:

3 0
1 year ago
Read 2 more answers
What researcher pointed out that in small groups our greatest need is to know whether we belong to the group?
ki77a [65]

Hello, BellaBouye205. Your answer would be Kurt Lewin. In the later years of his life, he devoted his time to studying small social groups. He claimed that groups change people's behaviorally as an individual. He also said that the small groups flourished greatly whenever they were preformed in a democratic way. I hope I helped!! Have a great evening.

5 0
2 years ago
Read 2 more answers
Other questions:
  • For what purpose is the mineral halite commonly used?
    10·1 answer
  • How does nuclear fusion energy reach earth
    13·1 answer
  • Please fellow wizards of biology help your poor friend wizard to defeat the battle of life !!!
    8·2 answers
  • Which of these would BEST describe what would happen to a cell in a time of low nutrient supply?
    15·1 answer
  • A mangrove community has the following food chain:
    13·2 answers
  • This kingdom can live in harsh environments, like extremely hot or cold environments
    11·1 answer
  • Energy is conserved when thermal energy is transferred from your body to a coat.
    9·2 answers
  • Marine vascular plants include?
    10·1 answer
  • The colors of various main sequence stars are shown below.
    11·1 answer
  • Next Alicia places each part of the cabbage into its on plastic bag and adds a wet paper towel to each bag. She seals the bags s
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!