1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kkurt [141]
3 years ago
8

The first form of life on Earth was created from (2 points)

Biology
2 answers:
Cerrena [4.2K]3 years ago
6 0

The earliest known life forms on Earth are putative fossilized microorganisms found in hydrothermal vent precipitates. The earliest time that life forms first appeared on Earth is unknown.

Vinil7 [7]3 years ago
3 0

The first living form of life on this planet was created from dust and the being was man.

But The Physics of the Universe website says this: "The first living things on Earth, single-celled micro-organisms or microbes lacking a cell nucleus or cell membrane known as prokaryotes, seem to have first appeared on Earth almost four billion years ago, just a few hundred million years after the formation of the Earth itself."

Hope I helped!

You might be interested in
Is the sun is the ultimate source for energy on the Earth?
lana66690 [7]

Answer: The given statement is true.

Sun is the ultimate source for energy on the Earth. It is the natural and renewable source of energy on earth as it can easily be renewed and never run off. All living organisms which are present on earth are dependent on food for survival. For this, they become part of the food chain which provides them energy in the form of food. Food chain begins with plants as they are the primary producers in the food chain. They get energy for preparing food from sunlight in the form of light energy.

Moreover, the life forms which existed millions of years ago were dependent on sun for energy. The dead remains of these life forms have provided the non renewable sources of energy like fossil fuels on earth.

Thus, the sun is considered as the ultimate source of energy on the Earth.

4 0
3 years ago
Read 2 more answers
Which set of classification terms is shown in order of increasing numbers of organisms per group.
Zigmanuir [339]
<span> species, genus, phylum</span>
3 0
3 years ago
Please I need help with number 12
gogolik [260]
What are the reactants in cellular respiration rearranged into?

Answer: Cellular respiration is the chemical reaction in which glucose and oxygen are turned into water, carbon dioxide, and energy (ATP). In this reaction, glucose and oxygen are reactants, while water, carbon dioxide, and energy (ATP) are products.
7 0
2 years ago
What is a centrosomes role in mitosis?
frosja888 [35]
To organize microtubules and provide structure for the cell, as well as work to pull chromatids apart during cell division
3 0
3 years ago
A model of blood sugar homeostasis is shown in the image here. Blood sugar levels are regulated by insulin and glucagon. When an
Luden [163]

Answer: A

Explanation: I HOPE THIS HELPED

6 0
2 years ago
Other questions:
  • Which of the following best describes how amino acids affect the tertiary structure of a protein
    9·1 answer
  • A female is homozygous for a recessive trait while the male is homozygous dominant for the same
    5·2 answers
  • ________ are reactants in a chemical reaction involving enzymes
    9·2 answers
  • Name one result of rock failure.
    10·1 answer
  • Why did identifying rock layers because of their fossils become important?
    11·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • _____ plants grow in moist environments so they can absorb water and nutrients by osmosis and diffusion.
    11·2 answers
  • The first cells activated by the antigens are called ?
    7·1 answer
  • !00 pointzzz<br> Help me nd yeahhh!! (see attachment)
    7·2 answers
  • Explain how an environment would rebound after a volcanic eruption (include the type of succession and pioneer species)
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!