1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vazorg [7]
3 years ago
12

Is natural selection is random? 2. What processes do you know of that make our DNA different and drives evolution and natural se

lection (there are at least 2)?
Biology
1 answer:
34kurt3 years ago
8 0
Evolution is not a random process. The genetic variation
on which natural selection acts may occur randomly, butnatural selection itself is not random at all.
You might be interested in
What is the relationship between Microvilli of gut, epithelium, glucose, circulatory system, capillary fenestrations, glucose/AT
diamong [38]

All of these are the components of the catabolic pathway or using the nutrients to provide energy from it. The breakdown of food molecules begins in the mouth and continues to the small intestine. The nutrients are absorbed through the wall of the small intestine which. The surface of the intestine wall is specially modified (contains a huge number of hair-like structures-microvilli) which increase nutrient absorption. (more area for nutrients to be absorbed).  The digestive tract is lined with mucosa which consists of simple columnar epithelial cells. Monomer subunits of the food, like glucose are than absorbed and diffused down a concentration gradient into capillary blood. Glucose is converted into pyruvate molecules through the process of glycolysis. Catabolism ends in the major energy-converting organelle, the mitochondrion, where the ATP is produced.

8 0
4 years ago
The definition of distillation is to _______. (1 point)
Zepler [3.9K]
The answer is A it's the action of purifying water
8 0
3 years ago
What statement best describes the relationship between the products of photosynthesis and the reactants in cellular respiration
zalisa [80]

The products of photosynthesis is to gain energy and build compounds, like glucose from carbon dioxide, making it anabolic

The reactants of cellular respiration are catabolic, and that refers to the breaking down of compounds, which releases energy.

The relationship is that they're complex compounds that consist of materials coming from essential processes in the cell.

8 0
3 years ago
What is the difference between catabolism and anabolism
Maru [420]
Anabolism stores energy and Catabolism releases energy
6 0
3 years ago
What is the one thing every living thing must either make or get from another living thing?
valkas [14]
<span>Every living thing needs food. Whether it makes it, or gets it from another living thing by eating that living thing. No living thing can survive without a food source. Food is where you get the energy for life.</span>
3 0
3 years ago
Other questions:
  • HELP FOR BRAIN! WHO WILL HELP LETS SEEEEEEEEEEEEEEEEEE:o
    10·2 answers
  • Thanks to our unique ____, life on earth was able to flourish.
    5·2 answers
  • A clinical research study is evaluating cells that bridge both the innate and adaptive immune systems. A nurse has identified th
    10·1 answer
  • The experimental technique that involves transfer of dna from an electrophoresis gel to a membrane, followed by detection with a
    15·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • How does a cardinal help limit the size of the sunflower population in its ecosystem
    11·2 answers
  • All of the following are traits of echinoderms except
    10·2 answers
  • Which agent of erosion is mainly responsible for the formation of the barrier islands along the southern coast of Long Island, N
    5·2 answers
  • Why blue whales so big
    9·2 answers
  • What is chromosomal abnormality is characteristic of cml?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!