1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Licemer1 [7]
3 years ago
8

Which of these types of blood cell is a lymphocyte

Biology
1 answer:
diamong [38]3 years ago
6 0

Neutrophils, eosinophils and basophils are also called granulocytes

You might be interested in
Which predictions made by lamarck turned out to be valid?
Alisiya [41]

Lamarck represented the hypothesis that an organism can pass on acquired characteristics during its lifetime to its offspring. This theory was rejected, but nowadays discoveries in the field of epigenetics and somatic hypermutation confirmed part of it and highlighted the possible inheritance of behavioral traits acquired by the previous generation.

4 0
3 years ago
Identify each statement as a hypothesis, theory, or law. Higher air pressure causes fuel to burn at a faster rate.
aliina [53]

Identify each statement as a hypothesis, theory, or law. Higher air pressure causes fuel to burn at a faster rate.                                                  Answer: theory

8 0
3 years ago
Uracil Pairs With_______.<br> Any nitrogen Base<br><br> Thymine<br><br> Uracil<br><br> Adenine
LenaWriter [7]

Answer: Uracil Pairs with Adenine

Explanation:

Uracil is like the thymine from RNA

7 0
1 year ago
At divergent plate boundaries, plates move:
alexandr402 [8]

Answer:

At divergent plate boundaries, plates move away from each other.

Explanation:

6 0
4 years ago
Which of these cell organelles is MOST
Zarrin [17]

Answer:

the golgi body

Explanation:

the golgi body

6 0
2 years ago
Read 2 more answers
Other questions:
  • Which of the following statements is false?
    5·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • What is the basis of the metric measurement system?
    6·2 answers
  • Suppose that a person eats a diet of 2397 calories per day.
    5·1 answer
  • Compare and contrast binary fission and conjugation. Which process increases genetic diversity?
    12·1 answer
  • What would influence a species' physical appearance
    5·1 answer
  • How does the immune system work with other body systems to prevent and fight disease?
    14·2 answers
  • 1. MATCHING: Match the correct geological era with the items listed below. Choices will be used more than once. 1. The first one
    11·1 answer
  • What does heat flow inside Earth move the tectonic plates?​
    14·1 answer
  • Cm grl fst
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!