<span>A In spring and summer to coincide with the growing season
</span>
Cell membranes serve as barriers and gatekeepers. They are semi-permeable, which means that some molecules can diffuse across the lipid bilayer but others cannot.
Answer:
DNA, cell membrane, cytoplasm, and ribosomes.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
