1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dem82 [27]
3 years ago
14

A reaction to a change is called a _____.

Biology
1 answer:
Leto [7]3 years ago
7 0
Response would be correct, as in response to environment.
You might be interested in
________ is a hormone that is released from the ________ to stimulate the production of red blood cells.
Alisiya [41]
Erythropoietin is a hormone that is released from the kidneys to stimulate the production of red blood cells.
8 0
3 years ago
How does conjunctivitis impact the community ?
guapka [62]

Answer:

This is an epidemic form of conjunctivitis which almost always affects both eyes. The patient may complain of a foreign body sensation, with watering, discharge, redness, and swelling of the lids. They may also complain of the eyes being sensitive to light, with blurred vision.

7 0
3 years ago
1) State three economic importance of Amoebiasis,​
aliina [53]

Answer:

An amoeba's economic value can be found in medicine and nutrient recycling. According to Biology Reference, certain amoeba species can cause sickness and death, while others are important in maintaining healthy ecosystems because they recycle the nutrients needed by bacteria and keep the bacterium population under control.

<u>OAmalOHopeO</u>

3 0
3 years ago
____________ is the process by which inhibitory transmitters cause the inside of the neuron to become more negative.
lidiya [134]

Answer:

Hyperpolarization

Explanation:

At the synapse, neurotransmitters bind to neurotransmitter receptors in the postsynaptic neuron’s plasma membrane. This results in the opening of the ions channels and the flow of specific ions to change the voltage across the membrane. An inhibitory neurotransmitter inhibits the firing of the action potential by making the inside of the membrane more negative. It is called hyperpolarization (inhibition).

It may occur when the neurotransmitter opens the Cl– or K+ channels to allow the movement of chloride ions into the cell while permitting the outward movement of potassium ions to make the inside of the cell more negative.

8 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • What plant cells contain dna that decides how they take shape and function?
    13·1 answer
  • To determine whether ammonia is produced from peptones (proteins), ____________ is added to the sample and will change color if
    9·1 answer
  • Why do humans have bigger pulvic bones than four legged animal?
    12·1 answer
  • PLZ HELP! WILL GIVE BRAINLIEST!!<br> (listen to Tiagz! His new song 'Isabelle' just came out today)
    10·2 answers
  • A Topographic map would be most useful for which activity
    5·1 answer
  • What characteristics Of bacteria would enable you to know it is a prokaryotic and not an eukaryote
    12·1 answer
  • Consider the cell structure that is shown below.
    13·1 answer
  • _______________________ is an animal's ability to blend into its surroundings.
    15·2 answers
  • What is the advantage of radial symmetry for sessile animals such as hydras and bilateral symmetry for mobile animals such as pl
    8·1 answer
  • You will write an argumentative essay to the “Bill and Melinda Gates Foundation” to convince them to support the use of genetica
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!