1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sineoko [7]
3 years ago
5

A fully functioning enzyme molecule is arranged in a complex three-dimensional shape. this shape determines the

Biology
2 answers:
Anit [1.1K]3 years ago
5 0
<span>This shape determines the </span><span>specific type of molecule it interacts with
during a reaction. </span><span>Enzymes are composed of a linear chain of amino acids that fold during the translation process to give rise to a three-dimensional tertiary structure of the enzyme<span> , capable of presenting activity.</span></span>
garik1379 [7]3 years ago
4 0

A fully functioning enzyme molecule is fold into a complex three-dimensional shape and this structure determines the specific type of molecules it interacts with during a reaction. Each functioning enzyme molecule has a particular structure to bind <span>with a high degree of specificity to one or a few molecules and to carry out its function. Therefore, cellular function is directly associated to its structures.</span>

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
What component of Earth's atmosphere exists entirely as a result of photosynthesis?
lozanna [386]

Answer:

oxygen gas

Explanation:

because oxygen is needed for life on Earth

5 0
3 years ago
Read 2 more answers
Did T. Rex have hair?
Mazyrski [523]

Answer:

rex was covered in a coat of downy feathers

Explanation:

Some mammals did have hair but T. Rex mostly had feathers

5 0
3 years ago
Read 2 more answers
Which structure is directly involved in gas exchange?
Marysya12 [62]
I would say the alveoli. They are tiny air pockets in the lungs: this is where the diffusion of oxygen and carbon dioxide occurs.

Hope this helps! x
4 0
4 years ago
Read 2 more answers
Why do the finch species look so different on the Galapagos Islands?
Verdich [7]

Answer:

B.When the finches migrated to new islands with food sources,they needed to adapt in order to survive.

6 0
3 years ago
Other questions:
  • An atom that gains or loses electrons is called
    9·2 answers
  • Need help with this pls ❤️
    6·2 answers
  • What are 3 fundamental axes of rotation​
    12·1 answer
  • When two populations of organisms are in competition, they
    12·2 answers
  • In an experiment, the factor that we measure is called the ​
    7·1 answer
  • The χ2 value means nothing on its own--it is used to find the probability that, assuming the hypothesis is true, the observed da
    12·1 answer
  • Why do parents and offspring often appear similar?
    14·1 answer
  • Which type of mountain is formed due to the collision of two different kinds<br> of plates
    14·2 answers
  • The transfer of nitrogen from the atmosphere to the soil, to living things, and back to the atmosphere is...
    8·1 answer
  • why don't we have the same means of livelihood in the different provinces and regions of the country?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!