During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
<span>The correct answer is C. lack of competition. It was exactly the opposite, the competition caused them to adapt and change their beak shape and size in order to be more proficient in getting food. This is what he described in his theory on how finches speciated and became genetically different from other finches similar to them.</span>
Answer:
a. on the outer surface of the epiphyses.
Explanation:
Articular cartilage of a long bone is found on the outer surface of the epiphyses.
Answer:
Centrioles is only found in animal cells