1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrRa [10]
3 years ago
15

One of the monosaccharides is a building block of a plant's cell wall. It is

Biology
1 answer:
ch4aika [34]3 years ago
4 0
The answer its Glucose. 
You might be interested in
Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i
Marat540 [252]

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

7 0
2 years ago
All of the following contributed to speciation in Darwin's finches except
neonofarm [45]
<span>The correct answer is C. lack of competition. It was exactly the opposite, the competition caused them to adapt and change their beak shape and size in order to be more proficient in getting food. This is what he described in his theory on how finches speciated and became genetically different from other finches similar to them.</span>
8 0
2 years ago
Read 2 more answers
Articular cartilage of a long bone is found Select one: a. on the outer surface of the epiphyses. b. inside the medullary cavity
Kay [80]

Answer:

a. on the outer surface of the epiphyses.

Explanation:

Articular cartilage of a long bone is found on the outer surface of the epiphyses.

3 0
3 years ago
9. Which structure is found ONLY in animal cells?
Mumz [18]

Answer:

Centrioles is only found in animal cells

4 0
3 years ago
Read 2 more answers
Hindus refer to the three most important parts of Brahman as:
sammy [17]

Answer:

D. Trimurti

Explanation:

thanks hope it helps

6 0
3 years ago
Read 2 more answers
Other questions:
  • Certain bacteria living in a human's large intestine help to produce vitamin K. The bacteria get nutrients from the human. This
    6·1 answer
  • During the first phase of the ovary cycle, the ______ matures within a follicle.
    13·1 answer
  • What is the bruising of brain tissue as the result of a head injury?
    10·1 answer
  • Which bacteria lives in the root nodules of leguminous plants?
    6·1 answer
  • When do scientists believe life originated on Earth?
    7·1 answer
  • A cell will use this type of division when it needs to produce exact copies of itself. What is it? ​
    8·1 answer
  • Which macromolecule includes steroids
    15·2 answers
  • is there a way to get ur roblo.x acount back when somone hac.ks ur acount and u dint put a email or phone number on the acount
    5·1 answer
  • 3) Briefly describe in a paragraph your learning Online experience as a Science​
    7·1 answer
  • What are the following a basin, channel, confluence, riparian zone?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!