2 years ago

Can two organisms with the same phenotype have different genotypes?

1 answer:

4 0

Let's look BB and Bb

They both have the dominant trait which means they both have the same physical appearance (phenotype) , but while BB has both dominant and Bb has one dominant and one recessive that means that although Bb has the same phenotype as BB, it has a different genotype because it has a bit different genetic makeup

You might be interested in

Iron rich deposits that formed about 2 billion years ago have red layers. Layers formed before then were not red. The red layers

Amanda [17]

Answer:

D. The biosphere change the lithosphere

Explanation:

The red formed due to oxygen which is produced by plants in the process of photosynthesis. This oxygen then reacted with iron atom and formed oxidized iron layers of sedimentary rock. So here plants are responsible for the formation of these layers and we considered plants as part of biosphere so we can say that biosphere is responsible for the change of lithosphere.

3 0

2 years ago

How much of the solar energy that enters the Earth's atmosphere actually reaches the earths surface

Aleksandr [31]

Answer:

51% is absorbed by earth

6 0

2 years ago

What is the mRNA in TACCGGATGCCAGATCAAATC?

Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0

2 years ago

Approximately 71% of Earth is covered with salt water. This salt water comprises

statuscvo [17]

Answer:

one global ocean

Explanation:

7 0

2 years ago

In order for precipitation to take place which process in the water cycle must take place first

Anna007 [38]

Condensation, which is the process by which water vapor is changed back into liquid water. Then precipitation occurs.

3 0

2 years ago