1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kitty [74]
3 years ago
14

What are the seven classifications of a dog?

Biology
1 answer:
PtichkaEL [24]3 years ago
4 0
<span>lupus familiaris Anamalia, Chordata, Mammalia, Carnivora, Canidae, Canis and Canis Canis lupus.</span>
You might be interested in
Which of the following represents a polar covalent compound?<br> H₂O<br> Cl₂<br> O2<br> NaCl
Vadim26 [7]

Answer:

NaCl

Explanation:

4 0
2 years ago
Describe the benefits to using tissue cultures to study medications used for treating cancer cells
liberstina [14]

Medications can be tested on cell cultures instead of being injected into patients unnecessarily.

Cancer cells continue to grow in the cultures uncontrollably allowing scientists to test multiple medications on the cancer cells.

7 0
3 years ago
Read 2 more answers
Do inner planets have a rocky surface
GREYUIT [131]

Answer:

Yes

Explanation:

6 0
3 years ago
Read 2 more answers
Please select the word from the list that best fits the definition
Elanso [62]
Where’s the list? Put it and I’ll help.
6 0
3 years ago
Read 2 more answers
The __________ is the innermost region of the brain.
Andru [333]
The Brainstem is the innermost region of the brain 
4 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following statements is correct? a)All animals share a common ancestor. b)Sponges are diploblastic animals. c)Eumet
    11·1 answer
  • Select all that apply. Genetic codes contain _____.
    14·2 answers
  • Direct gene activation involves a second-messenger system. True or False
    9·2 answers
  • New regulations for how Australia, New Zealand and other countries in Oceania manage economic growth and protecting natural reso
    5·1 answer
  • In food chains, the flow of energy is ALWAYS _________.
    14·2 answers
  • What family is potassium
    7·1 answer
  • eating too much fat and can cause cholessterol to build up in blood vessels. When a blockage occurs, a heart attack happens.​
    15·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • What are the organized pieces of DNA called
    15·1 answer
  • what effect does the nervous system have on the heart rate? stimulation by sympathetic nerves sets the resting heart rate of the
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!