1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elis [28]
4 years ago
15

In which group is parthenogenesis a normal event?

Biology
1 answer:
bezimeni [28]4 years ago
5 0

Answer:

Bees

Explanation:

Parthenogenesis is a method of asexual reproduction in which an egg cell develops into a new individual without fertilization. Parthenogenesis occurs in insects, amphibians, reptiles, fish, and in some plants. Most of the organisms which reproduces through parthenogenesis, they also reproduce sexually. Parthenogenesis may be occurs by apomixis and by automixis. In apomixis, egg is produced by mitosis and results into diploid clones. In automixis egg is produced by meiosis and the haploid egg develops into diploid new individual by the duplication of chromosomes. Parthenogenesis is an adaptation which allows to reproduce in adverse environmental conditions when sexual reproduction is not possible.  

You might be interested in
What are some similarities for prophase and telophase
sergey [27]

Answer:

Both prophase and telophase have a complete set of chromosomes and organelles.

5 0
3 years ago
Pls help i don't understand :( Will Mark Brainliest!! + 25 Points!!]
Grace [21]

Answer: A

Explanation:

7 0
3 years ago
the outer ear channels sound waves down the external __________ to the __________, a tight membrane that vibrates in response to
aivan3 [116]

Answer:

Revisado por: Larissa Hirsch, MD

Larger text sizeLarge text sizeRegular text size  

Print

in English

Ears

¿Qué es el oído y qué hace?

El oído consta de tres partes diferentes, que funcionan conjuntamente para captar sonidos y transmitírselos al cerebro: el oído externo, el oído medio y el oído interno.

El oído externo

El oído externo está formado por el pabellón auditivo (también conocido como "pabellón auricular" o "pabellón de la oreja") y el conducto auditivo. Los pabellones auditivos son las partes visibles que tenemos a ambos lados de la cabeza y están compuestos por cartílago duro cubierto de piel. La principal función del pabellón auditivo consiste en captar sonidos y conducirlos hacia el conducto auditivo, que conecta con el oído medio. Las glándulas de la piel que recubren el interior del conducto auditivo fabrican cera o cerumen, que protege este conducto, eliminado la suciedad y ayudando a prevenir posibles infecciones.

El oído medio

El oído medio es una cavidad llena de aire que transforma las ondas sonoras en vibraciones y las transmite al oído interno. El oído medio está separado del externo por el tímpano (o membrana timpánica), una fina lámina de tejido que va de lado a lado del conducto auditivo y que está fuertemente tensada sobre él. Los sonidos golpean el tímpano, haciendo que se mueva.

Explanation:

4 0
3 years ago
If room temperature is 25 degrees celcius, which fatty acid is a solid at room temperature? Which is liquid at room temperature?
IceJOKER [234]
Glycerides of higher fatty acids are oils are fats. Oils are liquids while fats are solids at room temperature or at 25 degree Celcius. Oils have some unsaturated acids forming triglycerides while fats are glycerides of mainly saturated higher fatty acids. Hope this helps.
8 0
3 years ago
Read 2 more answers
1. Living things carry out the chemical activities of life by using
Yakvenalex [24]

Question 1. A

Question 2. C

Hope this helped

3 0
4 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Starting with light energy, carbon dioxide, and water, which of the following sequences of biological steps explains how Usain B
    5·1 answer
  • Density gives us information about how atoms in a material are
    12·1 answer
  • If the number of photosynthetic organisms on the earth decreased drastically, which would happen as a result?
    6·2 answers
  • Scientists believe that the first prokaryotes on Earth arose ________ years ago, and the first eukaryotes arose ________ years l
    11·1 answer
  • Which of the following shows the correct order from most simple to most complex: atom, molecule, organelle, macromolecule molecu
    5·1 answer
  • What's the relationship between photosynthesis and cellular respiration?
    10·1 answer
  • State how the protein and energy requirements of the following will differ from those of a 16 year old female who does not take
    12·1 answer
  • PLEASE HELP EMERGENCY!! IF YOU ARE NOT 100% SURE ABOUT YOUR ANSWER DO NOT ANSWER THEN!! PLEASE!!
    11·2 answers
  • What will happen to the frequency of the recessive allele for the hbs gene when there is an outbreak of malaria? the frequency w
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!