1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Brilliant_brown [7]
3 years ago
5

Which of these is a type of mass movement that is likely to happen after a large amount of rain?

Biology
1 answer:
Allushta [10]3 years ago
6 0

A. Landslide


When sloped areas become saturated by heavy rainfall landslides can occur.

You might be interested in
Why are flowers important to plants?
Igoryamba

Answer:

The Answer I believe to be correct is A. They attract birds and insects to assist in pollination.

Explanation:

6 0
3 years ago
Read 2 more answers
Beak of the Finch Summary
ELEN [110]

Answer:

where is the video please show its

4 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
HELP ASAP WILL MARK BRIANLIEST!!! What are the differences between global and local winds?
KatRina [158]

Answer: Good examples of local winds are sea breezes and land breezes, and mountain and valley breezes. Local winds cover very short distances. Global winds are really large air masses that are created mainly as a result of the earth's rotation, the shape of the earth and the sun's heating power.

3 0
4 years ago
Read 2 more answers
Which of the above is the macromolecule that contains starch and glycogen? Carbohydrates II. Lipids III. Proteins IV. Nucleic Ac
Eduardwww [97]

Carbohydrates

I'm not sure but....Please correct me if I'm wrong!! :)

6 0
4 years ago
Other questions:
  • Plz help I’m hopeless
    12·1 answer
  • Henry was studying two populations of the same species of lizards. One population lived on an island and the other lived on the
    12·1 answer
  • EASY 15 POINTS!
    13·1 answer
  • How long will a golf ball stay in the air after being dropped?
    8·1 answer
  • The process of chromosome reduction occurs during:
    9·1 answer
  • What are the 4 major types of organic molecules
    10·1 answer
  • Can someone help me with this? My teacher just gives us papers to full out and doesn't teach at all.
    14·1 answer
  • Which shell adaptation did you choose for part two and why? Discuss the results and the effectiveness of the adaptation.
    8·1 answer
  • Santos and Lüderitz are the same distance from the equator, and both cities are near the ocean. The air temperature in Lüderitz
    7·1 answer
  • Which of the following indicates a cockroach problem
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!