1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olasank [31]
3 years ago
11

If a sRNA is bound to the ribosome binding sequence of a mRNA coding for an enzyme in a bacteria, what offect will tis have on t

he amount of enzyme in this cel? O Decrease O Increase
Biology
1 answer:
sasho [114]3 years ago
6 0

Answer:

Decrease

Explanation:

Gene expression, which involves the production of useful gene products, occurs in two stages: transcription and translation. Transcription synthesizes a mRNA transcript by copying the information in the nucleotide sequence of a DNA. This mRNA sequence is then read during translation to synthesize amino acids (proteins) in a process called translation.

Translation is initiated when a transfer RNA (tRNA) binds to the binding sequence of the mRNA in the ribosome. However, gene expression (translation) in bacteria are regulated by short non-coding nucleotide sequences called small RNA or sRNA. sRNA's are regulators that inhibits translation by binding to the initiation site on the mRNA molecule, thus preventing the binding of the tRNA for translation to proceed.

If a sRNA binds to the binding site of a mRNA coding for an enzyme, it means the rate at which the enzyme (protein) will be produced will be low or not at all. Hence, there will be a decrease in the synthesis of that particular enzyme.

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Why has the kingdom protista been abandoned? see concept 28.1 (page 592) view available hint(s) why has the kingdom protista bee
liberstina [14]
The answer is the second and third answers. Kingdom Protista is a polyphyletic taxon, meaning they did not evolve from one common ancestor, unlike what you see from a monophyletic taxon. Because they come from multiple ancestors, they share more similarities with other organisms from other kingdoms, rather than themselves.  
4 0
3 years ago
Cells that secrete protein fibers in bone are called
Jet001 [13]

Answer:

Osteoblasts

Explanation:

Cells that secrete protein fibres in bones are called osteoblasts.

I hope this helps.

3 0
3 years ago
If the pregnant mother gets dizzy and has a drop in blood pressure when she is in a supine position, the condition is called?
Elena L [17]

Supine hypotension syndrome is the medical term for when a pregnant woman feels lightheaded and has a dip in blood pressure while lying down.

Supine hypotension in pregnancy: what is it?

  • When you're pregnant, resting flat on your back might make some symptoms, including indigestion and shortness of breath, worse. Her blood pressure may also drop as a result of it.
  • Supine hypotension syndrome is the medical term for when her blood pressure drops while she is pregnant and laying on her back. When a pregnant woman lies supine, the gravid uterus pushes on the inferior vena cava, resulting in a reduction in central venous return. This condition is known as a supine hypotensive syndrome (also known as inferior vena cava compression syndrome).

Learn more about supine hypotensive syndrome here:

brainly.com/question/28039475

#SPJ4

4 0
2 years ago
Small molecules that bind with self-proteins to produce antigenic substances are called ________. reagins antibodies haptens ion
puteri [66]
The answer will be haptens because haptens has the ability of combining to carriers that are large enough to produce antibodies. The large carriers are usually the proteins that binds to it after producing antibodies. The antibodies, ions and reagins does not comply in the question above for antibodies focus more in the immunization. The ions are the electrons that produce positive or negative electric charge and the reagins are the ones responsible in allergic reactions.
7 0
4 years ago
Other questions:
  • The structure that temporarily stores food in an amoeba is called
    13·1 answer
  • The skeletal muscle complex known as the triad consists of
    15·1 answer
  • How do you calculate magnification on a microscope
    6·1 answer
  • `What is 10% rule.What is its significance?Why is energy lost?
    6·1 answer
  • Brian is interested in plants. He notices that most plants always grow in an upward direction, which is against gravity. He cond
    14·2 answers
  • The antibiotic penicillin is isolated from
    15·1 answer
  • The hand is located at what end of the forearm<br> Interior<br> Distal<br> Proximal<br> Medial
    12·2 answers
  • 1.
    10·1 answer
  • Unregulated cell division can result in _____.
    11·2 answers
  • Which of the following would NOT
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!