Answer:
If we did not have an atmosphere, we would fly out into space. We would also not be protected from harmful rays from the sun, and astroids. Human life would not live very long.
Explanation:
Hope this helps! :)
This should be True
Seafood Watch has had an immense influence on decisions regarding illegal fishing practices and has helped design sustainable seafood environments due to their lists of seafood that should be eaten without worries.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
Hey mate....
Explanation:
This is ur answer....
<em>The number of flights performed globally by the airline industry increased steadily since the early 2000s and reached 38.9 million in 2019. However, due to the coronavirus pandemic, the number of flights dropped to 16.4 million in 2020.</em>
Hope it helps you,
mark me as the brainliest....
Follow me! ;)
