A complete pathway through the nervous system, beginning with a stimulus and ending with a response, is called a/n:

Biology

1 answer:

BaLLatris [955]3 years ago

5 0

Answer:

A. reflex arc

Explanation:

The reflex arc is the immediate response to the excitement of a nerve without the will or consciousness of the animal, ie it is a stimulus that does not reach the brain, it receives response in the marrow.

Reflex arcs can be simple or complex depending on the number of components involved. In the case of complex reflexes we have several muscles responding to a stimulus, such as swallowing and scratching. In simple reflexes, the components are smaller and usually the response is obtained in a single effector organ, such as in the stretch reflex, where a single muscle is recruited.

You might be interested in

Many years of evolution is most likely to produce

Kamila [148]

D) differences between species and their ancestors

This is because of the adaptive mechanism and mutations the organisms have to respond to. Adaptation processes occur to help species survive and thrive in the ecological balance of life. Structural adaptations are physical features of an organism that adapted through time. An example of this are the bills of a bird and the fur of bears that they generally need for their survival; birds for hunting, and bears to protect them from low climate areas.

4 0

2 years ago

A long bone is covered externally with a sheath called the __________, whereas the marrow cavity is lined with the __________.

vesna_86 [32]

I suggest you to provide some options, as it's quite difficult to answer your question. Here is your answer: A long bone is covered externally with a sheath called the periosteum, whereas the marrow cavity is lined with the endosteum. I've attached the illustration to make it clear for you

4 0

2 years ago

Paul, sean, and mike have each consumed four beers in the last two hours. paul weighs 220 pounds, sean weighs 165 pounds, and mi

Goshia [24]

Sean, who weighs the least of the three, will have the highest blood alcohol concentration (BAC).

The less a person weighs, the more they will be affected by a given amount of alcohol. People of the same weight, even the same gender, individuals with a lower percentage of body fat will have lower blood alcohol concentration than those with a higher percentage of body fat.

Hope this helps! :)

3 0

2 years ago

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0

2 years ago

What happens to the carbon dioxide (CO2) levels of a plant when it does or does not have light?

zubka84 [21]

Explanation:

Carbon dioxide is needed for photosynthesis, but oxygen is needed for cellular respiration. Assuming there is still oxygen then the plants will produce carbon dioxide and some of it will be reabsorbed by photosynthesis during daylight. However, ultimately there wouldn’t be enough carbon dioxide for the plants to grow and they will start to die. Some plants have evolved a C4C4 photosynthesis pathway so they only require a small amount of CO2CO2 to survive, however they do still require more than zero CO2CO2.

So basically you killed off all the plants and all the other non-microbial life died of starvation shortly afterward.

Hope it helps...!! Please mark as brainliest

8 0

1 year ago