1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
denis23 [38]
3 years ago
12

Which region of your brainstem plays a role in arousing you to a state of alertness when, for example, you accidentally stumble

over another person's misplaced pair of shoes?
A. reticular formation
B. amygdala
C. hypothalamus
D. hippocampus
Biology
2 answers:
ivanzaharov [21]3 years ago
8 0

Answer:

Probably A.

Explanation:

The reticular formation can be said to be a network of nuclei in the brainstem that wakes or alert us to a sharp reaction or occurence at a particular time.

lyudmila [28]3 years ago
8 0

Answer:

Reticular formation.

Explanation:

The brain stem consists of the brain regions that are in continuity with the spinal cord. The brain stem is present in the posterior part of the brain and contains motor and sensory nerve supply.

The reticular formation is the important region of the brain stem that plays an important role in consciousness. This regions contains the motor nerve supply and involves in the arousal process whenever someone asked the question or when we find something.

Thus, the correct answer is option (A).

You might be interested in
Releasing hormones originate in which part of the brain
nadezda [96]
The pituitary gland, I believe, but don't quote me on this.
4 0
3 years ago
A scientist crosses a homozygous red flower with a homozygous white flower. All of the resulting off spring are heterozygous wit
miss Akunina [59]

Answer:

the red flower gene is dominant, white is recessive, the cross was RR x rr yielding 4 Rr crosses with red flowers.

Explanation:

7 0
3 years ago
Read 2 more answers
Describe an environmental factor that could influence natural selection and increase genetic diversity.
Kipish [7]

Answer:

Explanation:

Environmental factors can influence natural selection because they can increase or decrease. ...

An increase in food and a decrease in predators would most likely genetic variation in a population. ...

In a few generations, this population of beetles changed.

3 0
3 years ago
Change in the pH should (activate, deactivate, have no effect) the enzyme.
Sloan [31]
I would say it deactivates, because enzymes are picky about the type of environment they are in and will only work if they have the right environment. Hope i help. 
5 0
4 years ago
Help me with the first question it’s 7 grade science
allochka39001 [22]

Answer:

B

Explanation:

4 0
3 years ago
Other questions:
  • The cell of humans contains 46 chromosomes and is about to undergo cell division. How many cells are created after meiosis? *
    13·1 answer
  • Give an example of the same volume but different mass<br><br> ??
    9·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Why are most systems in Why are most systems in the human body negative feedback systems? Negative feedback systems balance the
    14·1 answer
  • What is the act of adding water to crops?
    13·2 answers
  • PLEASE HELP I will mark brainliest for the correct answers
    7·2 answers
  • By analyzing past episodes of the quiz show, you realize that you will probably need 600 points to defeat Kimberly. You also not
    10·1 answer
  • Is protein alive? explain why or why not
    8·2 answers
  • Name three basic needs that organisms and cells share
    10·1 answer
  • Scientists discovered a new life form living in hot springs. What type of organism is it most likely to be?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!