1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iren [92.7K]
3 years ago
11

Foods used by animal cells include starches, sugars, and:

Biology
1 answer:
Iteru [2.4K]3 years ago
8 0

Answer:

3. fats

Explanation:

fats are in the food used by animal cells, fats and lipids can be used for things such as storing energy in the cells

hope this helps :)

You might be interested in
Can someone explain please
Luden [163]
Basically certain traits are going to give a better outcome for the animal the white rabbits living on white snow are going to be able to survive better than the brown rabbit and the population of brown rabbits will be reflected through the graph
7 0
3 years ago
How does the experimental design process inform forensic science? Cite one specific example and explain.
Andreyy89

One is through turgidity. this occurs before ground tissue ( collenchyma and sclerenchyma cells) become well developed to give structural support to the plant as it grows bigger. The xylem tissue (composed of rigid tissue) of the young plant render this support and also maintaining osmotic turgidity of the surrounding plant cells.

8 0
2 years ago
Kai looks at a photo of herself with her parents. She notices that, while her features are similar to her parents’ features, the
Pavlova-9 [17]

Explanation:

This is because the Genes of the parent that is transferred to Kai and get her parents features .

So, that's why her features are similar to her parents features and they do not appear to be identical .

7 0
3 years ago
Read 2 more answers
A pea plant has purple flowers what alleles for flower color could the sex cells carry
zavuch27 [327]
<span>It can eaither be PP or Pp.</span>
7 0
3 years ago
The frequency of alleles in a population that is in hardy Weinberg equilibrium?
maksim [4K]

The answer would be D.

HWE states that genotype and allele frequencies in a population remain constant from generation to generation when evolutionary influences are absent(such as gene flow or natural selection).

7 0
3 years ago
Other questions:
  • The Alvin was used to _____. recover a nuclear bomb study ocean currents gather data on the Arctic ice cap observe marine life i
    10·2 answers
  • Which progeny among generation iii are showing recombination between rflp1 and dominant disease locus?
    14·1 answer
  • I need answers for the shark dichotomous key worksheet.
    8·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Dark adaptation ________.
    13·1 answer
  • Which of the following statements about seafloor spreading is false?
    12·2 answers
  • Question 3
    12·1 answer
  • What is number 16 please
    10·1 answer
  • Which organism has lungs?<br> frog<br> insect<br> fish<br> jellyfish
    9·1 answer
  • What kind of reaction is responsible for the liberation of carbon dioxide in red blood cells
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!