1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mamaluj [8]
3 years ago
12

Science is ________.

Biology
1 answer:
stellarik [79]3 years ago
5 0

Answer:

d. all of the above

Explanation:

all the above answers are correct about Science

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Explain how the availability of resources in the environment is linked to exponential growth of a species
Alinara [238K]

Answer: Exponential growth occurs when resources in the environment are abundantly available to a species.

Explanation: When a food source amount drops, so does the survival rate of the predator that eats that specific food source. When a food source grows too abundantly at too fast a rate, predators increase in numbers.

7 0
3 years ago
19. What are Darwin's four main ideas of natural selection?
vichka [17]
<span>More individuals are produced each generation that can survive.

Phenotypic variation exists among individuals and the variation is heritable.

Those individuals with heritable traits better suited to the environment will survive.
<span>
When reproductive isolation occurs new species will form.</span></span>
7 0
3 years ago
How do volcanoes form at B? for the image go to the link below thank you
AysviL [449]
The is not a link for me to see lad.
8 0
3 years ago
What characteristic best distinguishes runoff and infiltration
Nikolay [14]

Runoff describes water movement and infiltration describes water storage.

8 0
3 years ago
Other questions:
  • Which is a tough and flexible layer that surrounds plant cells, as well as some algal and bacterial cells.
    11·2 answers
  • Compare being a colonial organism to being an individual organism.
    9·1 answer
  • How do plants and animals help each other obtain energy
    14·2 answers
  • Which of the following is not a way Science influence society
    14·1 answer
  • Day and night are caused by A. the rotation of the Sun on its axis. B. the Sun completing a full orbit around the Earth. C. the
    6·2 answers
  • What does the independent variable mean
    11·2 answers
  • Please Help me find 5 safety violations or more
    7·1 answer
  • PLEASE HELP!! ASAP!!Inherited traits are governed by-
    15·1 answer
  • Describe the connection between limiting factors and invasive spicies
    6·2 answers
  • Which stage controls the development of a community?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!