1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sauron [17]
4 years ago
11

Suppose that you use 0.75 g of iron in this experiment. what is the minimum volume of 1.5 m cuso4 solution required

Chemistry
1 answer:
allochka39001 [22]4 years ago
5 0
0.4g will get you the right amount
You might be interested in
Which of the following is true about two neutral atoms of the element gold? (1 point) The nucleus is missing in both. Each has a
klio [65]

i have the same question idk the anwser tho

5 0
3 years ago
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
Use the Internet to find the SDS for regular bleach (sodium hypochlorite, 4-6%).
gtnhenbr [62]

The SDS for regular bleach (sodium hypochlorite, 4-6%) for physical state is a thin liquid.

<h3>What is SDS?</h3>

SDSs provide students, researchers, workers, and emergency personnel with the proper procedures for handling a pure chemical, as well as information on what to do in an emergency situation involving the chemical.

The following items are:

A) Physical state

B) Routes of exposure and symptoms

C) Required protective equipment

D) First aid procedures

E) Fire-fighting measures

F) Chemical reactivity

G) Safe storage

H) Safe disposal

I) Environmental precautions and ecotoxicity

j) Spill cleanup procedures

A) Physical state : Thin liquid

B) Routes of exposure and symptoms :

Inhalation: Exposure to vapor or mist may irritate respiratory tract and cause coughing. Inhalation of  high concentrations may cause pulmonary edema.

Eye Contact:  Corrosive. May cause severe damage to eyes.

Skin Contact: May cause severe irritation to the skin. Prolonged contact may cause burns to the skin.

Ingestion: Ingestion may cause burns to the gastrointestinal tract and respiratory tract, nausea, vomiting,  and diarrhoea.

C) Required protective equipment :

Eye/Face Protection If splashes are likely to occur: Wear safety glasses with side shields (or goggles) or a face shield.

Skin and Body Protection Wear rubber or neoprene gloves and protective clothing such as a long-sleeved shirt.

Respiratory Protection If irritation is experienced, NIOSH/MSHA-approved respiratory protection should be worn.

Positive-pressure supplied air respirators may be required for high airborne contaminant concentrations. Respiratory protection must be provided in accordance with current local regulations.

Hygiene Measures Handle in accordance with good industrial hygiene and safety practice. Wash hands after direct contact. Do not wear product-contaminated clothing for prolonged periods. Remove  and wash contaminated clothing before re-use. Do not eat, drink, or smoke when using this  product

D) First aid procedures:

General Advice Call a poison control centre or doctor immediately for treatment advice. Show this safety data sheet to the doctor in attendance.

Eye Contact Hold eye open and rinse slowly and gently with water for 15 - 20 minutes. Remove contact lenses, if present, after the first 5 minutes, then continue rinsing the eye. Call a poison control centre or doctor for treatment advice.

Skin Contact Take off contaminated clothing. Rinse skin immediately with plenty of water for 15-20 minutes. Call a poison control centre or doctor for treatment advice.

Inhalation Move to fresh air. If breathing is affected, call a doctor.

Ingestion has the person sip a glassful of water if able to swallow. Do not induce vomiting unless told to do so by a poison control centre or doctor.

Do not give anything by mouth to an unconscious person. Call a poison control centre or doctor immediately for treatment advice.

Protection of First-aiders Avoid contact with skin, eyes, and clothing. Use personal protective equipment as required.

Wear personal protective clothing

E) Fire-fighting measures:

Suitable Extinguishing Media

Use extinguishing measures that are appropriate to local circumstances and the surrounding environment.

Unsuitable Extinguishing Media

CAUTION: Use of water spray when fighting fire may be inefficient.

Specific Hazards Arising from the Chemical

This product causes burns to the eyes, skin, and mucous membranes. Thermal decomposition can release sodium chlorate and irritating gases and vapours.

Explosion Data

Sensitivity to Mechanical Impact None.

Sensitivity to Static Discharge None.

Protective equipment and precautions for firefighters

As in any fire, wear self-contained breathing apparatus pressure-demand, MSHA/NIOSH (approved or equivalent) and full protective gear.

F) Chemical reactivity

Reactivity :

Reacts with other household chemicals such as toilet bowl cleaners, rust removers, acids, or products containing ammonia to produce  hazardous irritating gases, such as chlorine and other chlorinated compounds

G) Safe storage

Store away from children. Reclose the cap tightly after each use. Store this product upright in a cool, dry area, away from direct sunlight and heat to avoid deterioration. Do not contaminate food or feed by storage of this product.  

H) Safe disposal

Dispose of in accordance with all applicable federal, state, and local regulations. Do not contaminate food or feed by disposal of this product.

I) Environmental precautions and ecotoxicity

Environmental Precautions This product is toxic to fish, aquatic invertebrates, oysters, and shrimp. Do not allow products to enter storm drains, lakes, or streams.

Ecotoxicity

This product is toxic to fish, aquatic invertebrates, oysters, and shrimp. Do not allow product to enter storm drains, lakes, or streams.

j) Spill cleanup procedures

Methods for Cleaning Up Absorb and Containment. Wash residual down to the sanitary sewer.

Learn more about the SDS here:

brainly.com/question/14587983

#SPJ1

5 0
2 years ago
Give two examples of activities performed by the veterinarian
AURORKA [14]

Answer:

exp:

two ways of activities performed by a veterinarian is:

performing surgery and checkups.

8 0
3 years ago
The SI unit of pressure is the ______________.
steposvetlana [31]

The answer is Pascal

5 0
3 years ago
Read 2 more answers
Other questions:
  • What happens to the amount of energy when it is transferred from potential to kinetic?
    13·1 answer
  • Draw the Lewis Structure for NI3.
    10·1 answer
  • How will you prove that a given colourless liquid is an acid​
    15·2 answers
  • What is the percentage of nitrogen in the fertilizer urea ((nh2) 2co)
    13·1 answer
  • For a reaction system at equilibrium, LeChatelier's principle can be used to predict the A) activation energy for the system B)
    8·1 answer
  • Which has higher frequency - neutron or electron? Why?
    11·1 answer
  • A compound contains 73.47% carbon, 10.20% hydrogen and 16.33% by mass of oxygen. The
    13·1 answer
  • What is ionic bond,,,?​
    6·2 answers
  • Based on shape, what is the predicted relative solubility of 1-butanol, isobutanol, and tert-butanol? Based on size,
    13·1 answer
  • Nitrogen is an atom or molecules​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!