1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juli2301 [7.4K]
3 years ago
11

Please Helpp! ( ENVIRONMENTAL SCIENCE )

Biology
1 answer:
svet-max [94.6K]3 years ago
7 0
Engage in manufacturing
You might be interested in
What is Nondisjunction<br> and when does it happen?
dimaraw [331]

Answer:

I is when two or more chromosomes fail to separate, which makes daughter cells with abnormal amounts of chromosomes

Explanation:

Your welcome.

5 0
3 years ago
Use the dichotomous key to identify the fish pictured above. A) Lane snapper B) Black mullet C) Yellowfin grouper D) Black sea b
Vera_Pavlovna [14]

Answer:

Black Sea Bass

Explanation:

Jus did it on USA TestPrep

5 0
3 years ago
Read 2 more answers
Please answer worth 100 point n what direction does an applied force move an object?
ch4aika [34]

Answer:

1) in the direction of the applied force

2)when the movement is not in the direction of the applied force it is not work. But if a component, or part of the motion is in the direction of the applied force it is work.

3)Joules/sec

4)Force/displacement

6)Wedges and lever

5)conduction

6)radiation

7)there is no heat flow

8)The average kinetic motion of the particles increases, there is more thermal energy

9)The average kinetic motion of the particles decreases, there is less thermal energy

10)transverse wave

11) sound waves

12)they transfer energy through oscillations in matter

13)the speed of the pitched baseball

14)to detect speed and direction of blood flow

15)green and violet are reflected and red is absorbed

16)visible light

17)as heat

18)infrared light/infrared energy

19)reflection

20) yes, the forces emitted by having the same charge repells them.

21)the flow of electrons

22)You open the circuit and the electrons can't flow

23)You closed the circuit and the electrons can flow

24)I think you meant bipolar, this means 2 poles

5 0
3 years ago
What are two ways that Prokaryotic and Eukaryotic cells are different?
Crank
1. Eukrayotes cells contain membrane-bound organelles, such as the nucleus, while prokaryotes cells do not. 

2. Eukaryotes are often multicellular whilst prokaryotes are unicellular. Although there are some exceptions –unicellular eukaryotes include amoebas, paramecium, yeast.

hope this helps!
6 0
3 years ago
Which best describes transduction in bacteria
mrs_skeptik [129]

Answer:

Transduction is a process by which DNA is transferred from one bacterium to another by the action of a virus. It is also used to designate the process by which exogenous DNA is introduced into a cell by a viral vector. This is a tool that molecular biologists usually use to introduce a foreign gene in a controlled way into the genome of a recipient cell.

Explanation:

When bacteriophages (viruses that infect bacteria) infect a bacterial cell, their normal mode of reproduction consists in capturing and using the machinery of replication, transcription, and translation of the recipient bacteria cell to produce large numbers of virons, or produce particles. viral, including viral DNA or RNA and protein coat.

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which system protects us from radiation and the vacuum of space
    6·2 answers
  • An example of the interaction of the nervous and endocrine systems can be seen in our response to danger. The _______________ or
    8·1 answer
  • Will give brainliest:
    7·1 answer
  • A dodder plant wraps itself around a potato plant. Then the dodder uses its root system to obtain water and nutrients from the
    7·2 answers
  • A small, short-furred gray animal called a divos lives on an island. This island habitat is warm
    8·1 answer
  • You are observing a single cell under a microscope. You go home for the night, and the next day you see four cells. The four cel
    9·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • 2 examples of both absolute and relative dating
    11·2 answers
  • What dose the word spillway mean?
    10·1 answer
  • Pls give me one scientists who study or collect butterflies
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!