1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexxandr [17]
4 years ago
13

i need help with everything can someone help me i think i did the conversion wrong and i’m not tryna fail but i was absent and i

didnt understand anything so like im failing now

Biology
1 answer:
nevsk [136]4 years ago
5 0

Answer

Step 1

Toy 1 = 0.953

Toy 2 = 2.177

Step 2

Toy 1 = 953g

Toy 2 = 2177g

Explanation

Since we know that 1kg = 2.2026, if we divide 1kg by 2.2026, we get how much 1 pound is equal to. We then times that by the weight of the toy, and we get the weight in kg.

Toy 1

2.2046 lbs = 1 kg

2.1 lbs = ?

2.1 lbs =  \frac{1}{2.2046} X 2.1

= 0.9525

To the nearest thousandth = 0.953

Toy 2

2.2046 lbs = 1 kg

4.7 lbs = ?

4.7 lbs = \frac{1}{2.2046} X 4.8

= 2.177

To the nearest thousandth = 2.177

Step 2

To convert kilograms to grams, we times the kg total by 1000, to get the mass in grams. (1kg = 1000g).

Toy 1

0.953 x 1000 = 953g

Toy 2

2.177 x 1000 = 2177g

You might be interested in
Protecting endangered animals is a different process because
abruzzese [7]

Some of these animals habitats overlap with areas that humans count on for their livelihoods.

7 0
3 years ago
Describe what an enzyme is and how it works according to the lock and key model
Mila [183]
The Lock and Key Analogy of Enzymes and Substrates: Enzymes act as a catalyst in a given chemical reaction (for example, lactase allows lactose to break down into Glucose and Galactose); enzymes lower the amount of energy required to make a reaction occur. There is a key concept to this theory: Enzymes are designed work for only one reaction; there is only one key that fits the lock perfectly. Without enzymes, our bodies wouldn't be able to handle the amount of heat the reactions that occur inside if there weren't any enzymes (or the reactions just wouldn't occur! In the Lock and Key Analogy, the substrate (Lactose in the <span>example) is the "key".</span>
3 0
3 years ago
Which mrna sequences would form a structure that is a cue for transcription termination of some genes?
torisob [31]

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

5 0
2 years ago
List 5 different limiting factors that may exist for sea otters
Ganezh [65]
Food, water, shelter, air, sunlight
8 0
4 years ago
Who created a method for detecting arsenic in murder victims?
Pavel [41]

It is called The Marsh Test and it was created by James Marsh.

4 0
3 years ago
Read 2 more answers
Other questions:
  • What would acid would be use to remove bricks mortar
    12·1 answer
  • What can i do with a masters in nutrition?
    7·1 answer
  • Cuticle
    9·1 answer
  • In exothermic reaction,the energy stored in the reactants is _____ the energy stored
    5·1 answer
  • HURRY I NEED HELP
    10·1 answer
  • What dose Arthropod mean???? HELP PLZ
    12·2 answers
  • How much of our total body weight is water? 30-50 percent 40-60 percent 50-70 percent 60-80 percent?
    14·1 answer
  • Can anyone help with this problem ?
    5·1 answer
  • Fruit flies are commonly used in genetic investigations that focus on traits passed from parents to offspring over several gener
    13·1 answer
  • A thermometer is placed in water in order to measure the water’s temperature. What would cause the liquid in the thermometer to
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!