1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DerKrebs [107]
3 years ago
5

How does the size of oxygen's nucleus affect the distribution of electrons in the water molecules?

Biology
1 answer:
Readme [11.4K]3 years ago
5 0
How does the size of oxygen's nucleus affect the distribution of electrons in the water molecule<span>?

The </span>oxygen's nucleus<span> contains eight protons.</span>
You might be interested in
How many times do you vomit with the stomach flu reddit?
RoseWind [281]
Vomiting is a common symptom of the stomach flu - it starts a few hours after you're exposed to the virus so there isn't a certain amount of times you will vomit but drinking plenty of fresh, clean water will help you keep hydrated! :)
7 0
3 years ago
Which level of classification contains all the others?
solniwko [45]

Answer:

The answer is Kingdom .

Explanation:

Kingdom is place the highest in the level of classification .

6 0
3 years ago
_________________________ , _____________________ ,__________________, and ___________________are the four tasks completed by th
Vika [28.1K]

Answer:

ingestion, propulsion, mechanical or physical digestion, chemical digestion, absorption, and defecation

6 0
3 years ago
Diagrams,tables,and graphs are used by scientists mainly to
Feliz [49]

Since most of the data scientist collect is quantitative, data tables and charts are usually used to organize the information • Graphs are created from data tables • They allow the investigator to get a visual image of the observations, which simplifies interpretation and drawing conclusions • Valid conclusions depend ...

3 0
3 years ago
Read 2 more answers
Where do DAG and IP3 originate?
cupoosta [38]

Answer:

Option (4).

Explanation:

Phosphatidylinositol4,5-bisphosphate (PIP2) is the phospholipid present in plasma membrane. This lipid is important for the cell communication and cell signalling process.

The PIP2 can cleave and give two main products are DAG (diacylglycerol) and IP3 ( inositol 1,4,5-trisphosphate). These two molecules are important for the cell signalling.

Thus, the correct answer is option (4).

8 0
3 years ago
Other questions:
  • Use the drop-down menus below to match the scientist(s) to their contribution to the discovery of base pairings. studied the rol
    10·2 answers
  • "in june 2011, first lady michelle obama and the usda unveiled the federal government's new food icon, myplate, to help consumer
    7·1 answer
  • A researcher examines the effect of adequate prenatal health care on infant mortality. adequate prenatal health care was defined
    13·1 answer
  • Which structure surrounds and protects an animal cell
    7·1 answer
  • Which of these examples might be an animal adaptation to life in the tree canopy of a tropical rainforest?
    11·2 answers
  • Answer This "for fun"
    11·1 answer
  • 6. After a person eats a large meal, glucose begins to move into the bloodstream and the
    13·1 answer
  • What type of agriculture is most characteristic of a third-world developing country?
    7·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • What are the simplest body structures
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!