Answer:
Iodine
Explanation:
Iodine is needed by animals because the body's metabolic rate is controlled by the action of an iodine hormone, called thyroxine, which is secreted by the thyroid gland in the neck.
If the animal fails to supply enough iodine through food to be able to make a normal amount of this compound, then the thyroid gland enlarges or expands trying to create enough, resulting in a common type of goiter.
The answer is D)carbone dioxide,water and energy
Carbon dioxide is an example of a Greenhouse gas transported by the cardiovascular system to excretory organs and tissues
The mass of the object is 57 ml
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: