1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sammy [17]
3 years ago
9

As a cell increases in size, which increases more rapidly, it's surface area or volume?

Biology
1 answer:
shutvik [7]3 years ago
7 0
The cell's volume increases more rapidly.
Let's say you have a cube. When it's side have a length of one, the SA us 6 units while the volume is only one. By the time it's 10 by 10 by 10, the SA is 600 and the volume is 1,000.
You might be interested in
Someone plz heeeeelp! Plz
emmasim [6.3K]
Genetic engineering is the direct manipulation of a specific gene. I would use it in this scenario
7 0
3 years ago
How are cell structures adapted to their functions
hjlf
Differentiation is the way they adapt to their functions
8 0
2 years ago
Cuales sin las interacciones intraespecificas?
Mashutka [201]

Answer:

Las interacciones interespecíficas son determinantes importantes de la dinámica de la población y la estructura del paisaje puede influir en estas interacciones. Todas las especies interactúan con depredadores, parásitos, competidores, etc., como parte biótica de su entorno.

Explanation:

4 0
3 years ago
Read 2 more answers
What is the cycle for land and sea breezes?
Vladimir [108]

Answer: A sea breeze occurs due to the difference in temperature between the ocean and the land. As land heats up during the afternoon, air above it begins to rise forming a low pressure are near the land. then cool air, situated in high pressure areas, spreads across the water and moves in over land.

Explanation:

4 0
3 years ago
Mutations are
solong [7]

Answer:

either helpfu, harmful or neutral

8 0
2 years ago
Other questions:
  • A substitute is a good that is​ _____ another​ good, and a complement is a good that is​ _____ another good.
    9·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • n horses, the hair color gene has a dominant allele B (Black) and a recessive allele b (Chestnut). The gait gene has a dominant
    8·2 answers
  • Which of the following statements about translation is FALSE?
    13·1 answer
  • Explain what a mosaic is and then explain why the term fluid mosaic model is used to describe the plasma membrane
    12·1 answer
  • One of the critical aspects of watson and crick's discovery of the structure of dna was that it __________.
    5·2 answers
  • which statement correctly compares and contrast the three stages of cellluar respiration that occurs in the presence of oxygen
    15·1 answer
  • What is genetic biodiversity?
    5·1 answer
  • In aerobic cellular respiration, glycolysis is followed by
    11·1 answer
  • Please help!!
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!