Answer:
The code for heredity is carried on genes in each organism's DNA. Explanation; Genes are portions of the genome that codes for a protein or an RNA, Hereditary information that is contained in nucleotide sequence of DNA.
Explanation:
That substance was most likely parathyroid hormone.
<h3>What is a parathyroid hormone?</h3>
It should be noted that the parathyroid hormone is the hormone that is released to control calcuim levels in the blood.
In this case, this is illustrated as the blood calcium levels were above normal and the pathologist found cancer cells that produced a hormone-like substance.
Learn more about hormones on:
brainly.com/question/64686
#SPJ12
The answer is: Chloroplasts.
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer:
Virion Release
Explanation:
Mechanisms for virus release from cells include cell death (lysis), budding, and exocytosis. The cytoskeleton can bestow a barrier to release and some unenveloped viruses encode proteins that intrude the cytoskeleton to allow dispersal of newly assembled virions.
