1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jasenka [17]
3 years ago
10

What are two ways that organisms are connected to the nonliving enviroment

Biology
1 answer:
Alekssandra [29.7K]3 years ago
4 0
Plants need soil in order to survive.
Living organisms beed water in order to survive
You might be interested in
What are some possible solutions for managing tropical rainforests?
vichka [17]
You can restore damaged ecosystems by planting trees on land where forests have been cut down. Or you can encourage people around you to live in ways that don't hurt the environment.
6 0
3 years ago
Read 2 more answers
Gene 1: TYR Gene amino acid sequence?​
Novosadov [1.4K]

Explanation:

<h3>The amino acid sequence of tyrosinase from neurospora crassa </h3>

<em>monophenol,</em><em> </em><em> </em><em>dihydroxyphenylalanine,</em><em> </em><em>oxygen</em><em> </em><em>oxidoreducatase </em><em>.</em>

8 0
3 years ago
A measuring cylinder contains 40 cm3 of water. When a stone of mass 69 g is dropped into the water, the stone sinks and the wate
rjkz [21]

Answer: 2.3 g cm^3

Explanation: In this case the rise in level of water is same as the volume occupied by the stone.

a) Volume occupied by the stone = 70 cm^3 – 40 cm^3= 30 cm^3

b) Density = mass/volume

                  = 69g/30 cm^3 = 2.3 g cm^3

8 0
2 years ago
The table below shows the elements that mainly comprise each of the four layers of Earth: Elements in Layers Layer Main Elements
yanalaym [24]

Layer that is 0.2 to 1.1 percent of Earth's total diameter is the thinnest layer of the Earth- Crust.

So, the correct answer is: oxygen and silicone. The crust consists of tectonic plates (in relative motion one from another) and has 5–70 km (~3–44 miles) in depth. The most abundant elements of this layer are: oxygen-46.6 percent by weight; silicon-27.7 percent; aluminum-8.1 percent; iron-5 percent.


6 0
4 years ago
Read 2 more answers
If you had a sample organism and wanted to measure its rate of cellular respiration, which of the following methods would provid
Andrei [34K]
<h2><em>Aerobic Respiration</em></h2>

Explanation:

  • Aerobic cellular respiration is the process by which the cells of a living being separate <em>nourishment and transform it into the energy</em> they have to play out their essential functions
  • The most importance of <em>aerobic respiration in living</em> things can't be belittled Without this process, no living thing would survive
  • <em>Oxygen is a critical component of Aerobic respiration</em> in many animals
  • The motivation behind the oxygen is so significant is on the grounds that it assumes a critical job in the <em>mitochondria</em>, the <em>powerhouses of the cell</em>
  • The<em> mitochondria has two layers</em>. On the inward layer, 4 gatherings of protein structure the<em> Electron Transport Chain</em>
8 0
3 years ago
Other questions:
  • What is the best reason for assessing a neonate weighing 1,500 g at 32 weeks’ gestation for retinopathy of prematurity (ROP)?
    12·1 answer
  • What are the two foods that the deer eating
    13·2 answers
  • Jordan is doing a science fair project on the effects of music on the growth of tomatoes yes to tomato plants plan a.m. Plan B t
    9·1 answer
  • In which galaxy Betelgeuse found? Is Betelgeuse spiral, irregular or elliptical?
    15·2 answers
  • When minerals precipitate in a fracture, they are referred to as __________?
    10·1 answer
  • What is and example of an molecule
    7·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • When you hear digestive what do you think of
    11·2 answers
  • After using ammonia in an experiment, Artie had some left over. What should Artie do with the leftover ammonia?
    5·1 answer
  • Jill wants to conduct an investigation to determine what happens to the temperature of water if it is left in the sun. She place
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!