1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataly [62]
3 years ago
8

Explain why the plants from year 2-4 may not be present in year 25-50

Biology
1 answer:
aliya0001 [1]3 years ago
5 0

Answer:

ecological succession.

Explanation:

The plant may not be present in 25-50 years due to ecological succession. in ecological succession, the vegetation such as small plants that is present replaces by the more suitable vegetation such as trees because the vegetation (small plants) did not receive nutrients and sunlight so they are unable to grow and finally dies due to lack of basic needs. So that's why plant may not be present 25-50 years.

You might be interested in
How do enzymes interact only with specific substrates?
Taya2010 [7]
They have a certain shape of active sites which only fit in certain substrates
See lock and key theoru
4 0
3 years ago
Read 2 more answers
A neuron cell body reaches threshold and depolarizes. The depolarization propagates down the length of the ______, is chemically
Alex787 [66]

Answer:

Axon.

Synapse

Dentrite and cell body.

Explanation:

AXON is the transmission conduit for action potential through saltatory conduction at the nodes of ranvier.

Synapse refers to the gap between adjacent nuerones and the entire components of that particular gap.

Denrites which originated from the cell.body received the transmitted signals from.the axon,and transmits this for response at effectors:muscle and glands.

6 0
3 years ago
How is mitochondrial DNA (mtDNA) typing used in forensic science?
Rudiy27

Explanation:

<em>Mitochondrial DNA typing</em><em> </em><em>-</em>

This method is mainly used by forensic scientist who investigate crime scenes.

It involves the use of DNA from an unknown sample to match a DNA collected from a crime scene.

This method is normally used in special scenarios.

These scenarios include:

1) When the DNA is discarded.

2) When the sample does not contain nuclear DNA.

From the description above we can now answer the question as follows:

an unknown nuclear mtDNA is matched to a nuclear mtDNA found at a crime scene.

3 0
3 years ago
Which is an example of a fractional scale?
oee [108]

Answer:

Fractional or Ratio Scale: Afractional scale map shows the fraction of an object or land feature on the map. This type uses a set of numbers that represents the object or a landmark. As an example on the left photo, the orange-shadedscale represents a 2/3 fractional scale. 2.

6 0
3 years ago
Once you have stopped for a school bus, do not pass until the driver signals you to proceed, the red lights stop flashing,
DaniilM [7]
Once you have stopped for a school bus, do not pass until the driver signals you to proceed, the red lights stop flashing, or the bus starts moving ahead. Whenever a vehicle ahead of you stops to let  a pedestrian pass in front of you, you should stay in line and until the vehicle ahead proceeds. 
7 0
3 years ago
Other questions:
  • Which object is created during the formation of a start
    11·1 answer
  • A (n)_______ is a rapid growth of a colony of plant-like protists. A. carrageenan B. biocolony C. algal bloom D. eutrophication
    11·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A student planted two sunflower seeds in pots. There are the same number of water and soil. If she puts one plant on a sunny win
    15·2 answers
  • Carbon monoxide has ____ of oxygen.<br><br> zero atoms<br> one atom<br> two atoms
    9·2 answers
  • In the presence of lidocaine, the action potential was not affected at r1 because _______.
    9·1 answer
  • The study of biological classification is called<br> Your answer<br> Help please
    8·1 answer
  • What are 5 organs analyzed in the lab and what are their functions
    15·1 answer
  • Que es la velocidad media<br><br>​
    11·1 answer
  • Marge Simpson decided to start a new garden in her backyard. She heard that plants compete for space and decided to testis
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!