1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mariana [72]
4 years ago
7

Assume that you have 1 mL of a solution of amylase (an enzyme) at a concentration of 15 mg protein/mL. Calculate the volume of d

iluting buffer that you would have to add to 1.0 mL of the amylase stock solution if you wished the final concentration of the solution to be 345 µg protein/mL.
Biology
1 answer:
lidiya [134]4 years ago
8 0

Answer:

42,5 mL

Explanation:

We need to use the serial dilution formula beacuse we start with a stock concentrate solution and we need to prepare a new less concentrated one.

DF=\frac{Vi}{Vf}

<u>DF in the dilution factor, Vi is the initial volume and Vf is the final volume.</u>

The first step is to have the same measurment unit so we need to convert 345 µg to mg.

we know that 1 µg equals 0,001 g, hence:

345 µg = 0,345 mg

now the final volume is 0,345 mg  protein/ mL and the inital volume is 15mg protein/mL, both of them are in the same unit so we can use the formula

DF= \frac{15mg protein/mL}{0.345mg protein/mL}

DF= 43,5 mg protein/ mL

Now since the question said that we already have 1.0mL of the amylase stock solution we need to subtract that 1.0mL to the 43,5 mg protein/mL

43,5mL-1,0mL = 42,5 mL

So, we need 42,5 mL of diluting buffer if we want a final concentration of 345 µg protein/mL (0.345 mg protein/mL)

You might be interested in
Plants and animals that live in estuaries face a dilemma in maintaining water balance inside their cells. During high tide they
jok3333 [9.3K]

Answer:

The correct answer is "a hypertonic solution".

Explanation:

Seawater is the most clear example of a hypertonic solution in nature. The concentration of ions in seawater are far more superior than the concentration of ions inside a plant or an animal cell, since seawater have an osmolarity of about 1000 mOsm/l. Therefore, at high tide a plant or animal cell will be in a hypertonic solution, and the cells must have adaptions to avoid cell shrinking and dead.

6 0
3 years ago
What is the base unit for measuring mass?
WARRIOR [948]

Answer:

kg

Explanation:

the base unit of mass is kilograms (kg)

8 0
3 years ago
The coconut palm is now widely dispersed in the world because of ________.
Vedmedyk [2.9K]
Birds because they spread seeds
3 0
4 years ago
For many species living in variable environments, sexual reproduction has proven to be a better solution for reproduction than a
luda_lava [24]
CCCCCCCCCCCCCCCCCCCCCCCCCC
5 0
3 years ago
Which macromolecule makes up the main structure of the cell membrane?
erik [133]

Answer:

The principal components of the plasma membrane are lipids (phospholipids and cholesterol), proteins, and carbohydrate groups that are attached to some of the lipids and proteins.

3 0
3 years ago
Other questions:
  • Pizzazz help me!!!!!!!!!
    15·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Altering patterns of gene expression in prokaryotes would most likely serve an organism's survival by _____.
    15·1 answer
  • This occurs to bodies of rock when one body of rock moves relative to another. qizlet
    15·2 answers
  • Some animals are primarily asexual in their reproduction, but they have the ability to switch to sexual reproduction under certa
    8·1 answer
  • Describe the events by which depolarization of a smooth muscle cell results in contraction and explain why smooth muscle contrac
    7·1 answer
  • Which takes place during the second trimester of pregnancy?
    14·1 answer
  • All the different organisms that interact in a pond make up
    11·1 answer
  • Need help on this question
    10·1 answer
  • Which of the following statements is TRUE?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!