1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rodikova [14]
3 years ago
9

What is the impact of mutation on current medical treatment

Biology
1 answer:
saveliy_v [14]3 years ago
8 0
Mutations are disruptions in the human body
You might be interested in
Which pair of of apply to the same organism
nignag [31]
You need more context to answer this.
7 0
2 years ago
What strategies should be considered for an HIV vaccine?
Mrrafil [7]
A deeper study into the virus itself
8 0
2 years ago
An allergic reaction that is characterized by the eruption of pale red elevated patches is _____
Fed [463]
The answer is urticaria (also known as hives).
3 0
3 years ago
Read 2 more answers
Name the structure that increases the surface area of the small intestine in humans.
lutik1710 [3]

The name of the structure that increases the surface area of the small intestine in humans is Villi.

<h3>What are the functions of the small intestine?</h3>

The small intestine performs a key role in the digestion of undigested food which comes through the stomach. It also absorbs all the essential minerals and nutrients from the food and is used by the body.

Villi or microvilli is the structure that increases the surface area of the small intestine for food absorption and adding digestive secretions.

Therefore, the name of the structure that increases the surface area of the small intestine in humans is Villi.

To learn more about the Small intestine, refer to the link:

brainly.com/question/17315460

#SPJ1

7 0
2 years ago
At sea level, the atmospheric pressure is ______ pounds per square inch.
AlexFokin [52]
The answer is c.....
4 0
2 years ago
Read 2 more answers
Other questions:
  • Psychologists are supposed to make the most ethical decision they can in any circumstance. Please select the best answer from th
    6·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Cell grows in size and other organelles duplicate
    13·1 answer
  • In an experiment, what is the factor that is tested?
    14·1 answer
  • Which of the following environmental factors would positively influence the survival and reproduction of only light peppered mot
    12·1 answer
  • Can someone help me out with brainless to the correct answer please hurry I really need this ​
    9·1 answer
  • The Punnett square below shows the genotypes of Amelia's parents. R alpha If R represents the dominant gene for straight hair an
    14·1 answer
  • Where are CO2 and O2 found in our enviromment?
    7·2 answers
  • Need Help). Question 1): Photosynthesis and cellular respiration are often described in two ways: 1) they are chemically opposit
    6·1 answer
  • Imagine a population evolving by genetic drift, in which the frequency of allele k is 0.8. what is the probability that at some
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!