1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sladkaya [172]
2 years ago
7

Which of the following does not cycle quickly! A) Wood B) Oil C) Water D) Carbon

Biology
2 answers:
Ganezh [65]2 years ago
4 0

My answer choice is B and my second option is D i am very indeed sorry if I'm wrong.

miv72 [106K]2 years ago
3 0

Answer:

I believe it is be

Explanation:

Depending on the type  oil, it can be natural and  non renewable

You might be interested in
What is the difference between plant ecm and mammalian ecm?
Rudiy27
ECM is the extracellular matrix, or the set of extracellular molecules secreted by cells with the purpose to support surrounding cells. In plants the cell wall is the ECM and in mammals ECM can be in the form of fibrils and may constitute a significant portion of the bulk of the organism and it also referred as connective tissue. 
3 0
2 years ago
When plants require large amounts of water and fertilizer to grow, the disadvantage is small or nonexistent?
RSB [31]

Answer:

D

Explanation:

8 0
3 years ago
Read 2 more answers
¿Qué tipo de luz UV se usa en las camas de<br> bronceado y por qué es tan peligroso?
MrRa [10]

¿Qué tipo de luz UV se usa en las camas de

bronceado y por qué es tan peligroso?

3 0
3 years ago
Growth factors and cytokines both lead to tyrosine phosphorylation through receptors, but they do so through different mechanism
gladu [14]

Answer:

The growth factor receptors have a kinase domain while the Cytokines receptors do not contain a kinase domain as part of their structure.

Explanation:

The two are signaling molecules that control cell activities in some manners, such paracrine, endocrine and autocrine manners.

The receptor kinase domain can be specific for substrate sites in which phosphorylation occurs.

3 0
3 years ago
improved intravitreal aav-mediated inner retinalgene transduction after surgical internal limitingmembrane peeling in cynomolgus
coldgirl [10]

Because it is easily accessible and has a mild immune response, the retina makes a good target for gene therapy.

  • In a mouse model, the inner retina was highly effectively transduced by an intravitreally injected adeno-associated virus (AAV) vector.
  • The vitreous and internal limiting membrane (ILM) operated as obstacles to transduction in large animals, reducing the efficacy of retinal transduction.
  • Before administering AAV vectors, we performed vitrectomy (VIT) and ILM peeling on cynomolgus monkeys to get around these obstacles.
  • The findings suggest that surgical ILM peeling prior to AAV vector delivery would be beneficial for retinal disease treatment and safe for effective transduction of the nonhuman primate retina.

Learn more about the adeno-associated virus (AAV) with the help of the given link:

brainly.com/question/28205495

#SPJ4

5 0
1 year ago
Other questions:
  • Which of the following is not a negative factor of nonnative species?
    12·1 answer
  • What is microbiology?
    15·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Explain the concept of wave-particle duality?
    13·1 answer
  • Which material most likely has the highest level of permeability?
    15·2 answers
  • Which term completes the sentence given below?
    9·1 answer
  • A male beetle has the genotype ttbb. if this beetle mates with a female with genotype ttbb, what is the chance their offspring w
    12·1 answer
  • What is the main difference between a prokaryote and a eukaryote?
    11·2 answers
  • Y’all help meeeee
    12·1 answer
  • A ____________________ reaction is a severe response to an allergen, also known as anaphylaxis.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!