1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gennadij [26K]
4 years ago
9

Some scientists believe that global warming will bring about extreme weather.

Biology
2 answers:
Sergeu [11.5K]4 years ago
7 0

The answer to this question is true

nalin [4]4 years ago
6 0

Answer:true :))

Explanation:

You might be interested in
What is oh if enzymes
mylen [45]
Enzymes are biological molecules (typically proteins) that significantly speed up the rate of virtually all of the chemical reactions that take place within cells.
5 0
3 years ago
Which disorder is a less severe but chronic form of depression?
choli [55]

Answer:

Persistent depressive disorder.

Persistent depressive disorder, known as dysthymia or low-grade depression, is less severe than major depression but more chronic. It occurs twice as often in women as in men. Persistent depressive disorder (PDD) is a serious and disabling disorder that shares many symptoms with other forms of clinical depression.

4 0
2 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
The innermost layer of the meninges is the
Sphinxa [80]

The innermost layer of the meninges is the pia mater.

4 0
3 years ago
What is not an example of radiant energy?
Studentka2010 [4]
C. the sun^^^^^^^^^^^^^
7 0
3 years ago
Other questions:
  • How does human activity affect the environment
    14·1 answer
  • Indentify a true statement about duffusion
    6·2 answers
  • Blood rich in oxygen and nutrients are transported from the placenta to the fetus by the
    6·1 answer
  • What is the difference in the amount of a molecule through a space
    7·1 answer
  • What is the next step in the scientific method, following stating a question?
    9·1 answer
  • A close evolutionary relationship between annelids and mollusks is suggested by the presence of a _____ larva in both phyla as w
    13·1 answer
  • In what ways could globalization possibly impact negatively and/or positively your current or future work environment.
    5·1 answer
  • The bloodstream is part of the circulatory system but also plays a role in all systems. Describe the role blood plays with the e
    15·1 answer
  • Carbon credits are used to a. rehabilitate tropical rainforests b. reduce the emission of volatile organic compounds (VOC's) c.
    15·2 answers
  • a plant leaf is 0.04mm long. calculate the length of the image after the cell has been magnified 500 times
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!