1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Flauer [41]
3 years ago
9

Which of the following conditions is most likely to result in changes in allele frequencies in a population. A. random mating. B

. Small population size. C. No migration into or out of a population. D. Absence of natural selection
Biology
1 answer:
amid [387]3 years ago
8 0
The answer to this is B
You might be interested in
As with any major scientific discovery, the previous work of many different scientists help contribute to final conclusions. Whi
4vir4ik [10]

<em>A</em>

<em>AExplanation:</em>

<em>AExplanation:Gregor Mendel is generally regarded as the father of genetics due to his three(3) laws of genetics. Non of his work alluded to the existence of the DNA molecules( i.e. the major constituent of genes) let alone its structure. </em>

5 0
2 years ago
LEVEL 3 02 The Gulf stream carries water fron the east coast of The United States to the We coast of Europe. A Warm C. Freezing
Alecsey [184]

Answer:

The Gulf stream carries WARM water fron the east coast of The United States to the West coast of Europe.

6 0
2 years ago
Roots spread<br> out under grounds<br> like the branches<br> of a tree why?
Mrac [35]

Answer:

roots spread out underground like the branches of a tree as to get sufficient water and nutrients form the soil to transport to the other parts of the tree for its own growth , by spreading out roots tend to collect or suck the maximum nutrients

7 0
3 years ago
A wildlife biologist is investigating a sudden increase in the death rate
Ann [662]

Answer:

circulatory and respiratory

Explanation:

The body system of Birds possesses a higher arrangement of organs to perform a particular function. The organs form a system which includes the organs and associated structures.

When the biologist observed the shortage of the dissolved oxygen and increase in the level of dissolved carbon dioxide, this could be the result of the failure of the circulatory system which supplies these gases on the body and the associated respiratory system which helps in the exchange of these gases with the atmosphere.

Thus, circulatory and respiratory is the correct answer.

5 0
3 years ago
What is the difference between variable and fixed costs?
VladimirAG [237]
"<span>Based on variability, the costs has been classified into three categories, they are fixed, variable and semi variable. </span>Fixed costs<span>, as its name suggests, is fixed in total i.e. irrespective of the number of output produced. </span>Variable costs<span> vary with the number of output produced. </span>Semi-variable<span> is the type of costs, which have the characteristics of both fixed costs and variable costs".</span><span>


<span /></span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following blood types is considered a "universal receiver"? A B AB O
    10·2 answers
  • Is it possible for one biome to change from one type to another?
    12·1 answer
  • What are the three different types of protists?
    5·2 answers
  • One reason farmers might choose non-GM crops over GM crops is because non-GM crops are A. less safe. B. more productive. C. less
    5·2 answers
  • What animal has the simplest and least organized nervous system?
    15·2 answers
  • Which animal has a single-loop circulation?
    13·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • 1. In cellular respiration, stored energy is released from ____________ molecules and transferred to ____________ molecules, whi
    11·1 answer
  • A fern is a seedless vascular plant because it has vascular ____ that transports water, nutrients, and food throughout the plant
    7·1 answer
  • Which of the following organ systems are involved in the uptake and transport of materials required for life-sustaining processe
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!