1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
motikmotik
3 years ago
12

Which of the statement(s) is (are) not right __________. a. mRNA: contains protein-building instruction b. tRNA: deliver free am

ino acids to ribosomes c. rRNA: a major component of ribosomes d. tRNA: deliver free nucleotides to ribosomes.
Biology
1 answer:
Alina [70]3 years ago
3 0

Hi there!

We can go through the overall function of all three of these:

mRNA: transcribed from the DNA, has the protein's composition written in it, and brings that to a ribosome where the protein will be made

tRNA: looks at the codons (set of 3 nucleotides) on the mRNA and brings amino acids which match up to that codon

rRNA: significant part of the composition of ribosomes

Now, looking at these, and back to the answer choices, we can already see that a, b, and c are correct. d, on the other hand, is incorrect.

Hope this helps! Feel free to let me know if you have any questions about this specific problem.

You might be interested in
What happens in the postsynaptic neuron when excitatory neurotransmitters bind to receptors?
zubka84 [21]

Answer:

it causes the depolarization of the target cell

Explanation:

Glutamate is an excitatory amino acid neurotransmitter that binds to specific receptors on the surface of target cells and thus causes its depolarization. During glutamate-mediated depolarization, the difference in charge inside and outside the cell is lost due to the entry of sodium and calcium positive ions into the postsynaptic cell (neuron) through specific ion channels. Moreover, glutamate binding also leads to the exit of potassium ions from the cell, thereby resulting in excitation. Through this mechanism, glutamate regulates many signaling pathways, such as those involved in memory, learning, emotions, cognition, motor control, etc.

6 0
3 years ago
Regulatory and basal transcription factors regulate transcription by binding to the promoter.A) True B) False
Licemer1 [7]

Answer:

False

Explanation:

In eukaryotes apart from RNA polymerase, the transcription of genes requires many different proteins called transcription factors. These transcription factors are important to initiate and regulate transcription.

There are two types of transcription factors regulatory and basal transcription factors. Basal transcription factors regulate transcription by binding to a gene promoter and regulatory transcription factor regulates transcription by binding to some regulatory sequences for example enhancers and silencers.  

Therefore only basal transcription factor binds to the promoter for regulating transcription. Therefore the statement is false.

4 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Which two sentences best explain what happens to the energy snails get fromo the plants they eat?
timurjin [86]

Answer:

Explanation:

D and c

5 0
3 years ago
Read 2 more answers
A gel-like substance is placed in a glass dish on top of a heat plate turned on low. The substance at first does not move. You a
dlinn [17]
Nonliving the heat from the hot plate is causing the gel like substance to move it's the same thing with liquid nitrogen how it seems to bounce off the floor it's because liquid nitrogen is super cold and the heat basically excites the electrons in the liquid nitrogen making it bounce off the floor same with the gel like substance the electrons in the gel substance are getting excited by the heat and jumping up and down but the substance itself is not alive
3 0
4 years ago
Read 2 more answers
Other questions:
  • Which environmental changes occur faster?
    8·1 answer
  • Complete the following statement: ATP energy molecules are the product of _____(1)_____. This energy comes from the reactant of
    10·2 answers
  • Choose the law that BEST explains the example:
    13·2 answers
  • Coal is a fossil fuel which is used to produce electricity. Which of these statements best describes an outcome of coal mining o
    10·1 answer
  • In 3 to 5 sentences, analyze potential impacts of oceans on human populations as the result of climate change in the current cen
    11·1 answer
  • (b) What major biological concepts, in
    6·1 answer
  • Are fish gills a Physiological adaptation or a Structural Adaptation?
    9·1 answer
  • The proximal tibiofibular joint can be compared to the proximal radioulnar joint. In what ways are these two joints similar, in
    12·1 answer
  • What is the difference between a predator and a parasite?
    8·1 answer
  • WORTH FOR 50 POINTS
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!