3 years ago

What is the final product of translation?

Biology

1 answer:

guapka [62]3 years ago

5 0

Answer:

the right answer is option D. proteins.

Explanation:

The molecule that results from translation is protein -- or more precisely, translation produces short sequences of amino acids called peptides that get stitched together and become proteins. During translation, little protein factories called ribosomes read the messenger RNA sequences.

I hope this is the answer. I'm not sure. but I think, it is.

You might be interested in

Which sentence uses a demonstrative adjective that points out something near?

NNADVOKAT [17]

This ring on your finger is beautiful

5 0

3 years ago

Definicion del nivel celular

olga2289 [7]

Answer:

Se llama el nivel celular que se compone de células. Mientras tanto, una célula es la unidad estructural y funcional más pequeña que puede reproducirse independientemente en un ser vivo. Las células suelen ser microscópicas.

Explanation:

6 0

3 years ago

What do ants eat?. Plz help :3

svetlana [45]

Sugar.....................

5 0

3 years ago

Read 2 more answers

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the

Ierofanga [76]

<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)

6 0

3 years ago

Which of the following best describes the function of the Golgi apparatus within plant and animal cells?

nekit [7.7K]

Answer:

The Golgi apparatus

Explanation:

The Golgi apparatus packages proteins into membrane-bound vesicles inside the cell before the vesicles are sent to their destination.

5 0

3 years ago