1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
brilliants [131]
3 years ago
6

What is the final product of translation?

Biology
1 answer:
guapka [62]3 years ago
5 0

Answer:

the right answer is option D. proteins.

Explanation:

The molecule that results from translation is protein -- or more precisely, translation produces short sequences of amino acids called peptides that get stitched together and become proteins. During translation, little protein factories called ribosomes read the messenger RNA sequences.

I hope this is the answer. I'm not sure. but I think, it is.

You might be interested in
Which sentence uses a demonstrative adjective that points out something near?
NNADVOKAT [17]
This ring on your finger is beautiful
5 0
3 years ago
Definicion del nivel celular
olga2289 [7]

Answer:

Se llama el nivel celular que se compone de células. Mientras tanto, una célula es la unidad estructural y funcional más pequeña que puede reproducirse independientemente en un ser vivo. Las células suelen ser microscópicas.

Explanation:

6 0
3 years ago
What do ants eat?. Plz help :3
svetlana [45]
Sugar.....................
5 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Which of the following best describes the function of the Golgi apparatus within plant and animal cells?
nekit [7.7K]

Answer:

The Golgi apparatus

Explanation:

The Golgi apparatus packages proteins into membrane-bound vesicles inside the cell before the vesicles are sent to their destination.

5 0
3 years ago
Other questions:
  • The first man-made satellite, Sputnik 1, was launched into space in 1957. This satellite was used to study the conditions found
    12·2 answers
  • What is the
    15·1 answer
  • Which of the following best describes evolution?
    6·1 answer
  • Which of the following is an example of maintaining homeostasis
    11·1 answer
  • he chart below shows the three main types of plant tissues and associated tissues. The chart shows the 3 main types of plant tis
    9·2 answers
  • Which of these statements is correct about a scientific law?
    10·1 answer
  • What hormone triggers development in females
    10·2 answers
  • At night, the concentration of carbon dioxide in the air in a forest is high. What is the main reason for this?
    7·1 answer
  • Red-green colorblindness is an X-
    9·1 answer
  • The enzyme that synthesizes rna primers for use in dna replication is _______________.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!