1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marissa [1.9K]
3 years ago
15

I need help please :(

Biology
1 answer:
earnstyle [38]3 years ago
5 0

Answer:

D. Cellular respiration is a process that producess glucose

Explanation:

Glucose is a reactant used in cellular respiration and NOT a product of it. Cellular respiration burns glucose and turns into ATP (energy)

You might be interested in
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
Mosses are examples of which type of plant?
Dahasolnce [82]

Explanation:

Botanically, mosses are non-vascular plants

4 0
3 years ago
How do the daughter cells at the end of mitosis and cytokinesis compare with their parent cell when it was in G 1 of the cell cy
Vikentia [17]

Answer:

b. The daughter cells have the same number of chromosomes and the same amount of DNA.

Explanation:

Mitosis is the cell division that maintains the DNA amount and chromosome number in daughter cells. This is due to the fact that each mitosis is preceded by one round of DNA replication in S phase.

For example, if the parent cell had 2n DNA in 46 chromosomes, the daughter cells at the end of mitosis and cytokinesis would also have 2n DNA in 46 chromosomes.

8 0
3 years ago
If an important cytoplasmic determinant were missing from an animal zygote, what would you expect to happen as the zygote develo
Strike441 [17]

Answer: Option E - One of the animal’s major body axes would fail to develop normally.

Explanation:

Cytoplasmic determinants help the organs of the embryo to develop.

Hence, absence of cytoplasmic determinants would result in one of the animal’s major body axes failing to develop normally.

7 0
3 years ago
Alisha and Rob would like to have children. A genetic counselor tells them that they are both carriers of a certain genetic dise
kupik [55]

Hi there!

With mendelian genetics and inheritance, it assumes that there are two alleles (a variant of a gene) for every trait, one from each parent. These two alleles can be dominant or recessive. This would result in different exhibitions of traits - as long as there is only one dominant allele, then the dominant trait is exhibited, even if there is the recessive allele. However, if there are both recessive alleles, then it is the recessive trait which is exhibited.

When a person is a carrier of a trait, in this case a genetic disease, it means that they carry the allele for the disease, but don't exhibit it. This would mean that the allele would be recessive, however they would also have a dominant allele which "overrides" this disease.

Hope this helps!

8 0
3 years ago
Other questions:
  • What is the relabonship between dna and proteins?
    12·1 answer
  • Which of the following is an example of the pattern of evolution? heredity descent with modification the inheritance of acquired
    11·1 answer
  • Hydrothermal vents pump super heated salt water into the ocean that is filled with various minerals. Because of this, there is a
    5·1 answer
  • Which parts of photosynthesis occur in the stroma of the chloroplast? Check all that apply.
    8·2 answers
  • In order to insert a human gene into a plasmid, both must ____
    15·1 answer
  • List these biomes in order from most biodiversity to least: grasslands, dessert, taiga, rainforest
    7·1 answer
  • A soil's structure will affect how much water the soil retains.<br><br> True<br> False
    5·2 answers
  • Giải thích hậu quả việc phá vỡ cấu trúc ko gian 3 chiều của phân tử protein
    11·1 answer
  • Explain how warm atmospheric conditions lead to severe storms.
    13·1 answer
  • what are the roles of cyclins and cyclin-dependent kinases during the cell cycle? how do perturbations of the cell cycle checkpo
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!