1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ipn [44]
3 years ago
7

What is the similarity between animalia and plantae kingdom

Biology
1 answer:
ASHA 777 [7]3 years ago
6 0

Answer:

Both of them have developed tissue system.                                                  Both of their cell are Eukaryote                                                                      Mitochondria and other cell organisms are found in both

You might be interested in
Minerals can a. provide energy to the body. b. become part of the body's structural systems. c. be degraded by the body. d. be d
slamgirl [31]

Answer:

b. become part of the body's structural systems.

Explanation:

  • Minerals are the inorganic regulators needed for different functions inside the body.
  • Minerals donot provide energy but involved in generation of energ through their metabolic function. (Hence option A is excluded)
  • They provide a good medium for the protoplasmic activities (permeability of cell membrane and normal functioning of cell)
  • Maintaining bod fluid balance.
  • For structural units.
  • Cannot be degraded in the body neither can be destroyed while cooking ( Hence option c and d are excluded)
  • They become the part of the body's strctral systems (Hence option B is the right answer)

3 0
3 years ago
Read 2 more answers
What is the boundary between the earths lower mantle and the upper mantle called ?
Alenkasestr [34]

Answer:

i have trusted my best to answer

Explanation:

Edit

The upper mantle of Earth is a very thick layer of rock inside the planet, which begins just beneath the crust (at about 10 km (6.2 mi) under the oceans and about 35 km (22 mi) under the continents) and ends at the top of the lower mantle at 670 km (420 mi). Temperatures range from approximately 200 °C (392 °F) at the upper boundary with the crust to approximately 900 °C (1,650 °F) at the boundary with the lower mantle. Upper mantle material which has come up onto the surface is made up of about 55% olivine, 35% pyroxene and 5 to 10% of calcium oxide and aluminum oxide minerals such as plagioclase, spinel, or garnet, depending upon depth.

5 0
3 years ago
The male reproductive system includes
SOVA2 [1]
C. the vas deferens.
8 0
3 years ago
Explain how mRNA is formed from the DNA template.
muminat

Answer:

mRNA is “messenger” RNA. mRNA is synthesized in the nucleus using the nucleotide sequence of DNA as a template. This process requires nucleotide triphosphates as substrates and is catalyzed by the enzyme RNA polymerase II. The process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

4 0
3 years ago
Help me pleaseeeeeee
Mila [183]
Hydrolysis is the answer good luck
4 0
3 years ago
Read 2 more answers
Other questions:
  • Help ASAP , easy 15 points and a brainly for the first one to reply , just answer the 2 questions
    14·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Where do organism obtain the energy they need
    7·2 answers
  • 3. A timeline is most effective for organizing information that
    8·1 answer
  • Which is one type of evidence that geologists usually study?
    6·2 answers
  • Why are plants and the bottom of the energy pyramid?
    8·2 answers
  • *EXTRA PTS* what is the speed at 6 seconds
    14·1 answer
  • A piece of DNA with instructions for one trait..?
    10·2 answers
  • Whats the difference between body cells and gametes
    14·1 answer
  • Explain why cell potentials are not multiplied by the coefficients in the balanced equation.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!