1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fiesta28 [93]
3 years ago
8

How do nucleus and riboson work together

Biology
1 answer:
vitfil [10]3 years ago
3 0

<u><em>Answer:</em></u>

<em>The nucleus and ribosomes both involve messenger RNA (mRNA) during protein synthesis. The mRNA is made during transcription within the nucleus. The mRNA then travels out to the cytoplasm via a nuclear pore of the nucleus.</em>

<em />

<u><em>Explanation:</em></u>

<em>*Hope this helped*</em>

<u><em /></u>

You might be interested in
What would happen if our skeleton are made up of a single bone.
AfilCa [17]

Joints:-Joints are the areas where 1 or more bones meet.Most joints are mobile,allowing the bones to move.Joints consist of the following:Cartilage . This is a type of tissuethat covers the surface of a bone at a joint.Next Ligaments:-Ligaments are short bands of tough,flexible tissue,made up of lots of individual fires,which connect the bones of the body together.Ligaments can be found connecting most of the bones in the body.The function of a ligament is to provide a passive unit to amount of movement between your bones.

7 0
2 years ago
Mass extinctions have occurred five times in Earth's history. The Permian and Cretaceous extinctions removed a large percentage
d1i1m1o1n [39]

Answer:

A. Species that remained after the extinction were able to radiate, new adaptations arose, and these adaptations produced the diversity seen today.  

Explanation:

When species went extinct they also left niches that could be occupied by "new" species; new places to live, places to be filled in the food web and different relationships to be formed. The wide availability of resources made organisms to radiate leading to a "new" diversity of shapes, sizes, and lifestyles.  

B. Species that have gone extinct were able to re-evolve from the ancestors that survived the extinction.  If you are extinct you are gone forever.  

C. Species that remained after the extinction were unable to speciate. Therefore, the number of species on Earth today is lower than the number of species present just before either extinction. The fossil record proves that species have changed over time and the diversity has changed over the history of Earth.

D. Species that remained after the extinction represented all of the lineages that were present before the extinction event. Therefore, extinction did not change the diversity of lineages. Again, the fossil record is evidence that lineages have changed over the history of the Earth.

8 0
3 years ago
What is an effect of adaptive radiation?
Vlad [161]

Answer: B! Many new species form.

Explanation:

Adaptive radiation refers to the process by which animals diversify rapidly from the ancestral species into different forms especially when resources are abundantly available. The effect of adaptive radiation is the emergence of new species, which exhibit different morphological and physiological traits.  

Hope this helps! :)

8 0
3 years ago
Characteristic of schinephyta<br>​
bija089 [108]

Answer:

Schizophyta is now commonly known as cyanophyta. Their characteristic are:

They are blue green algae. ...

They have organelle known as the thylakoid which are flattened, which help them in photosynthesis.

They obtain oxygen from the atmosphere for their energy and respiration.

Explanation:

8 0
3 years ago
Describe the process of photosynthesis, in your own words.
ioda

Answer:

photosynthesis process uses the sun's energy to combine carbon dioxide and water to form glucose, a sugar. Carbon dioxide enters plants through tiny pores in the bottoms of leaves or by diffusion through cell membranes in the case of algae and protists.

7 0
3 years ago
Other questions:
  • Pistol shrimp and gobies depend on each other for shelter and protection. They have a beneficial relationship with each other. W
    11·2 answers
  • Trihalomethanes in drinking water and the risk of death from esophageal cancer: does hardness in drinking water matter?
    11·1 answer
  • If cordycepin triphosphate is added to a cell-free transcription reaction, the nucleotide is added onto the growing rna chain bu
    9·1 answer
  • How has life been able to exist on Earth but not the other<br>four terrestrial planets?​
    7·2 answers
  • Which of the following observations BEST demonstrates water’s special property of cohesion?
    7·1 answer
  • What changes during a controlled experiment? A. A variable B. The results C. The conclusion D. The hypothesis
    13·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • XX=Female XY=Male.
    8·1 answer
  • What features relate cephalopods to other mollusks
    6·1 answer
  • Which study type of natural selection did grants observe when studying the beak size of galápagos finches
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!