1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
valentinak56 [21]
3 years ago
7

The site where the ureters enter the bladder is termed the _____ junction.

Biology
1 answer:
seropon [69]3 years ago
6 0
<span>The vesicoureteric junction</span>
You might be interested in
Which of the following best explains a characteristic that differentiates Fungi from Plants?
NikAS [45]
<span>The answer is C because fungi use decomposition to get nutrition, while plants produce their own nutrients, making them autotrophs. Answer choice A is incorrect because fungi cells do have cell walls, even though they contain chitin, which isn't present in the cell walls of plants. Answer choice B is incorrect because while they do form colonies, most fungi are multicellular. Answer choice D is incorrect because plants are also able to reproduce both sexually and asexually.</span>
4 0
3 years ago
Read 2 more answers
In a few generations, this population of beetles changed. A group of bugs includes 13 black bugs and 4 green bugs. After a few g
Andrei [34K]

Answer:

A. They moved to a greener habitat

Explanation:

7 0
3 years ago
Read 2 more answers
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
7. The chart describes several functions and examples of biomolecules.
Softa [21]
The answer would be lipids, they are a type of biomolecule and a nucle is an organelle
6 0
3 years ago
By the end of prophase, each of the following has occurred except ____.
Nataly [62]

Answer:

Lining up of chromosomes in the cell .

Explanation:

Prophase begins with the Thickening of chromosome. Chromosomes are clearly visible inside the nucleus. each chromosome splits longitudinally to form two chromatids.

The centriole in the centrosome of animal cell divides into two. The centrosphere set the centrioles free. Centrioles develop very fine eye-lash like thread called aster rays. the two asters start moving towards the opposite poles. By the end of prophase they reach at the opposite poles.

5 0
3 years ago
Other questions:
  • How many marine iguanas are left
    15·1 answer
  • In the 1990s, epidemiologic studies established that women could reduce their risk of bearing a child with neural tube birth def
    7·1 answer
  • One of Mendel’s principles also describes how different genes assemble unregulated with one another when reproductive cells deve
    10·2 answers
  • Mention two advantages of the extensive network of endoplasmic reticulum ​
    8·1 answer
  • Which best describes the function of the part labeled b?
    5·1 answer
  • Explain how prokaryotes can reproduce sexually and asexually.  In this discussion be sure to explain how the genetic material fr
    12·1 answer
  • I need this today please help me I’ll help you
    9·2 answers
  • Part 2: Fill in each statement using a (P) for potential energy or a (K) for kinetic energy
    7·1 answer
  • Will give Brainiest!!! Which statement best describes Mendel’s experiment
    10·2 answers
  • 3. jack is using plastic beads to model water molecules in each state of water. how shoule she the beads to represent water mole
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!