1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nostrana [21]
3 years ago
9

What is a terrestrial ecosystem

Biology
1 answer:
mihalych1998 [28]3 years ago
7 0
Terrestrial Ecosystem- Is a type of ecosystem found only on biomes.

Six primary terrestrial ecosystems exist: Tundra, Taiga, Temperate Deciduous Forest , Tropical Rain Forest, Grassland and Desert
You might be interested in
A elephant cell has 20 chromosomes. how many chromosomes will the cell have just before mitosis begins in the elephant cell?
lora16 [44]

The elephant cell will have 20 chromosomes.

Cells undergo interphase before getting to the mitotic phase. At the S phase of the interphase, the amount of DNA in the cell is double by replication. However, the number of chromosomes remains intact.

Thus, the cell gets to the mitotic phase with the same number of chromosomes that is usually present in normal vegetative cells of the animal.

More about mitosis can be found here: brainly.com/question/13536882?referrer=searchResults

8 0
3 years ago
PLEASE PLEASE HELP (20 points)<br> I will mark Brainliest
Nitella [24]

Answer:

Hope it helps :)

7 0
3 years ago
Spider monkeys live in a biome with many trees. they move around by swinging from tree to tree. spider monkeys do not build a ne
Nataliya [291]
Spider monkeys live in a <span>tropical rainforest

A savanna is a grassland with VERY FEW trees.
Polar ice is like Antartica.
The desert is all sand, no trees.
</span>
3 0
3 years ago
Read 2 more answers
31)
gladu [14]

Answer:

the answer is C

Explanation:

7 0
3 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Other questions:
  • The two parts of the syringe that should not be touched are
    8·1 answer
  • The Law of Segregation states that every organism possesses a pair of, , or different versions of a gene, for a trait and that e
    7·1 answer
  • How many species of hominin coexisted 100,000 years ago?
    10·1 answer
  • which human activity is not a significant factor in impacting the planet? industry agriculture urban development traveling
    12·1 answer
  • How does evolution unite all fields of biology?
    12·2 answers
  • What is the purpose of climate strike movement ?
    7·1 answer
  • The self-regulation of the internal environment of organisms or cells is called _____________.
    9·2 answers
  • Where is the foramen in this diagram of a bone from the vertebral column? a single bone of the vertebral column A. option A B. o
    10·2 answers
  • Which of the following steps is not likely to take place during cellular respiration?
    8·2 answers
  • Describe how plants are traditionally viewed in the organization of life found on earth
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!