In watermelons, solid green rind color (G) is dominant to stripes (g).

Biology

1 answer:

stiks02 [169]3 years ago

6 0

There are chances of 75% solid green coloured rind in watermelons.

Explanation:

Dominant trait = Solid Green rind G

Recessive trait= stripes g

Given that both the parent plants are heterozygous so their alleles will be

Gg Gg

From the Punnet square

G g

G GG Gg

g Gg gg

The phenotype ratio is 3:1 ( 3 watermelons with the green colour rind and 1 with striped rind observed)

Genotype ratio is 1:2:1

From the observation, we can say that 75% of the watermelons will have solid green colour rind because G is dominant over g.

You might be interested in

Would an amphibian that lacks lungs and breathes entirely through its skin likely be larger or smaller than an amphibian that ha

Ymorist [56]

Answer: .D. Smaller because its smaller surface area to volume ratio would allow it to breathe sufficiently through its skin alone.

Explanation:

7 0

4 years ago

Gunther touched a hot object and received a minor burn. How did the skeletal system help prevent further damage? The skeletal sy

gtnhenbr [62]

Answer:

The Skeletal system helped him move his hand away from the hot object.

Explanation:

The Skeletal system consists of our skeleton or the bones. The other options would be correct if the question asked about the<u> nervous system</u> instead of the skeletal system.

4 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved