1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitriy789 [7]
3 years ago
8

What happens when the motion of particles slows?

Biology
1 answer:
aliya0001 [1]3 years ago
8 0
The substance is colder than it was because when particles move very quickly its either how or boiling so if its slow its cold and if it freezed the particles are well frozen
You might be interested in
Given what you've learned about scientific hypotheses, theories, and laws, do you think a scientific theory can become.
kompoz [17]

Answer:

No. A law is something that happens without fail every time when being tested, or when it happens in nature. A law does not attempt to explain why the thing occurs, it only states it. A scientific theory is not something that can be tested on and will receive the exact same outcome each time. A theory attempts to explain an action seen in nature. Theories can be subject to change if new scientific data and research comes out, whereas laws cannot.

7 0
2 years ago
Marine science question: what skill would most likely benefit any scientist who is interpreting the result of a scientific exper
Alenkinab [10]

Answer: mathematics

Explanation:

Mathematics is the study of quantity, space, structure of a concerned entity or population size. A scientific experiment may be based on the analysis of variables must be having large sample size. Therefore, quantitative estimation  of the results is required. Hence, a scientist requires mathematics to interpret the results of a scientific experiment.

4 0
3 years ago
Read 2 more answers
Which statement best describes the function of dna in all cells
Mama L [17]

Answer:

encoding genetic information

6 0
4 years ago
Read 2 more answers
A codon is a set of three nucleotides that correspond to a specific amino acid. The table below shows various DNA codons and the
Finger [1]

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), th

Explanation:

6 0
3 years ago
Genetics!!! plz look at the photos attached....i have no clue what to do and it’s due very soon!
ra1l [238]

Question:

In order for your mutant dragon population to become its own species, and needs to be separated from the original dragon population so they no longer will mate with each other. come up with an idea of how the mutant dragon population can separate itself from the original population. Link it to your environmental change.

Answer:

There are various tactics that can be used to separate the mutant dragon population, in order to create a new speices. One tactic is to lure the dragons to a location that provides them with a better food supply. Another tactic could be to temporarily relocate the whelps or fledglings, and leaving behind a trail for the Family to follow. The goal is separate the mutant dragon population from the other, and the propositions that I have provided above could possibly be the solution.

Note:

This is the best I could do with the limited information that was given. I advise that you only resort to this if truly needed. I don't have much experience or knowledge in this Topic. I just thought I might give it a try. I hope you get a better answer soon!

6 0
4 years ago
Other questions:
  • A _____ is an area of land that drains to a common body of water.
    15·2 answers
  • Parasitism is a relationship between two organisms of different species in which one organism (the parasite) obtains resources,
    14·1 answer
  • A. In a purebred tall plant, what gametes are possible?
    12·1 answer
  • Which term should the nurse use when describing malignant tumors?
    8·1 answer
  • Some living organisms are capable of both asexual and sexual reproduction. Explain how this can be an advantage.
    11·1 answer
  • What is an adaptive radiation
    11·1 answer
  • What is does the lipid bilayer consist of?
    12·2 answers
  • Material between the connective tissue cells is called?
    12·1 answer
  • One long term side effect of diabetes
    12·2 answers
  • 4 myths about sexuality and how you might prove these are misconceptions
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!