1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snezhnost [94]
3 years ago
7

Cell theory states that __________ all living things are made of many cells. cells can be created from molecules spontaneously.

all living things are composed of cells and that all cells come from other cells. cells make up living and nonliving substances.
Biology
1 answer:
KengaRu [80]3 years ago
3 0
That the property of all living things are made of many cells
You might be interested in
Why do lipids make effective cell membranes in living cells?
ElenaW [278]
Lipids form the bilayer of cell membrane which act as a partially permeable mmbrane of cell to control the substances moving in and out of the cell.
7 0
3 years ago
Read 2 more answers
Darwin theorzed that evidence for the evoiution of new species can be found in the fossill record. Which observation supports th
VashaNatasha [74]

The gradual evolution for the family Equidae (horse family) has been well documented within the fossil record.

3 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Does facilitated diffusion use energy
alexandr402 [8]
Facilitated diffusion does not use cellular energy.

Since the transportation of molecules occurs through the concentration gradient, it doesn’t use cellular energy for transportation of molecules.
3 0
3 years ago
What is the great difference between male and female?
ad-work [718]

Answer:

Men are, in general, more muscular than women. Women are just over half as strong as men in their upper bodies, and about two-thirds as strong in their lower bodies

5 0
3 years ago
Other questions:
  • Which of the following describes asexual reproduction?
    10·2 answers
  • How can you use knowledge of a minerals chemical makeup or use
    13·1 answer
  • This DNA nucleotide is the base-pair for guanine
    7·1 answer
  • What's a world problem that could be solved with science?
    6·2 answers
  • In silkmoths, red eyes (re) and white-banded wings (wb) are encoded by two mutant alleles that are recessive to those that produ
    11·2 answers
  • How can you help in reducing the problem of waste disposal give any two methods​
    11·1 answer
  • Replication is performed prior to what
    11·1 answer
  • Match the description of the event with the phase of mitosis it is in. Each phase may be used more than once. a. Prophase b. Met
    15·1 answer
  • You are trying to find which wavelength of light would allow algae to do photosynthesis the worst (you want to prevent algal gro
    13·1 answer
  • How does the sucrose molecule leave the body?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!